Four and a Half LIM domains 1 (FHL1) - coding DNA reference sequence

(used for mutation description)

(last modified December 19, 2009)


This file was created to facilitate the description of sequence variants in the FHL1 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was generated from NG_015895.1, covering FHL1 transcript variant 1 NM_001159702.2

Several transcripts use an alternative promoter/exon 1; variant 8 upstream (exon 1a, NR_027621.1), variant 3 from intron 1 (exon 1b, NM_001159700.1), variant 4 from intron 1 (exon 01c, NM_001159704.1), variant 9 from intron 1 (exon 1d, NM_001167819.1), variant 5 from intron 2 (exon 2b, NM_001159701.1) and variant 7 from intron 2 (exon 2c, NM_001159699.1). All of these contain skip exon 7 and encode a different C-terminus. Transcript variant 2 (NM_001449.4) skips exon7, variant 6 (NM_001159703.1) exon 6 and 7.  

Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5029
                                cccgcccctggctagccgcgcccgccccc       c.-301
       alternative promoters  ^

 .         .         .         .         .         .                g.5089
 gcgctcctgcttcctcccctctttccctccccgcctcccaggcgcgcacccctcccctcg       c.-241

 .         .         .         .         .         .                g.5149
 cgcccctcccgcgccctacatccaccgcccggcggagggggctcagtccgcagccgccgc       c.-181

 .         .         .         .         .         .                g.5209
 cgccaccgccgcgcctcggcctcggtgcaggcagcggccgccgccgccgagacagctgcg       c.-121

 .         .          | 02        .         .         .             g.27547
 cgggcgagcatccccacgca | gcaccttggaagttgttttcaaccatatccagcctttgcc    c.-61
                      ^  alternative promoters

 .         .         .         .    | 03    .         .             g.64033
 gaatacatcctatctgccacacatccagcgtgag | gtccctccagctacaaggtgggcacc    c.-1

                                        P  S  S  Y  K  V  G  T      p.1-1
            alternative promoters  ^   (with alternative translation initiation start)

          .         .         .         .         .         .       g.64093
 ATGGCGGAGAAGTTTGACTGCCACTACTGCAGGGATCCCTTGCAGGGGAAGAAGTATGTG       c.60
 M  A  E  K  F  D  C  H  Y  C  R  D  P  L  Q  G  K  K  Y  V         p.20

          .         .         .         .         .         .       g.64153
 CAAAAGGATGGCCACCACTGCTGCCTGAAATGCTTTGACAAGTTCTGTGCCAACACCTGT       c.120
 Q  K  D  G  H  H  C  C  L  K  C  F  D  K  F  C  A  N  T  C         p.40

          .         .         .       | 04 .         .         .    g.64640
 GTGGAATGCCGCAAGCCCATCGGTGCGGACTCCAAG | GAGGTGCACTATAAGAACCGCTTC    c.180
 V  E  C  R  K  P  I  G  A  D  S  K   | E  V  H  Y  K  N  R  F      p.60

          .         .         .         .         .         .       g.64700
 TGGCATGACACCTGCTTCCGCTGTGCCAAGTGCCTTCACCCCTTGGCCAATGAGACCTTT       c.240
 W  H  D  T  C  F  R  C  A  K  C  L  H  P  L  A  N  E  T  F         p.80

          .         .         .         .         .         .       g.64760
 GTGGCCAAGGACAACAAGATCCTGTGCAACAAGTGCACCACTCGGGAGGACTCCCCCAAG       c.300
 V  A  K  D  N  K  I  L  C  N  K  C  T  T  R  E  D  S  P  K         p.100

          .         .         .  | 05      .         .         .    g.65421
 TGCAAGGGGTGCTTCAAGGCCATTGTGGCAG | GAGATCAAAACGTGGAGTACAAGGGGACC    c.360
 C  K  G  C  F  K  A  I  V  A  G |   D  Q  N  V  E  Y  K  G  T      p.120

          .         .         .         .         .         .       g.65481
 GTCTGGCACAAAGACTGCTTCACCTGTAGTAACTGCAAGCAAGTCATCGGGACTGGAAGC       c.420
 V  W  H  K  D  C  F  T  C  S  N  C  K  Q  V  I  G  T  G  S         p.140

          .         .         .         .         .         .       g.65541
 TTCTTCCCTAAAGGGGAGGACTTCTACTGCGTGACTTGCCATGAGACCAAGTTTGCCAAG       c.480
 F  F  P  K  G  E  D  F  Y  C  V  T  C  H  E  T  K  F  A  K         p.160

          .         .  | 06      .         .         .         .    g.66094
 CATTGCGTGAAGTGCAACAAG | GCCATCACATCTGGAGGAATCACTTACCAGGATCAGCCC    c.540
 H  C  V  K  C  N  K   | A  I  T  S  G  G  I  T  Y  Q  D  Q  P      p.180

          .         .         .         .         .         .       g.66154
 TGGCATGCCGATTGCTTTGTGTGTGTTACCTGCTCTAAGAAGCTGGCTGGGCAGCGTTTC       c.600
 W  H  A  D  C  F  V  C  V  T  C  S  K  K  L  A  G  Q  R  F         p.200

          .         .         .         .         .         .       g.66214
 ACCGCTGTGGAGGACCAGTATTACTGCGTGGATTGCTACAAGAACTTTGTGGCCAAGAAG       c.660
 T  A  V  E  D  Q  Y  Y  C  V  D  C  Y  K  N  F  V  A  K  K         p.220

          .         .         | 07         .         .         .    g.66875
 TGTGCTGGATGCAAGAACCCCATCACTG | GGAAAAGGACTGTGTCAAGAGTGAGCCACCCA    c.720
 C  A  G  C  K  N  P  I  T  G |   K  R  T  V  S  R  V  S  H  P      p.240
                              ^ alternatively spliced

          .         .         .         .         .         .       g.66935
 GTCTCTAAAGCTAGGAAGCCCCCAGTGTGCCACGGGAAACGCTTGCCTCTCACCCTGTTT       c.780
 V  S  K  A  R  K  P  P  V  C  H  G  K  R  L  P  L  T  L  F         p.260

          .         .         .         .         .         .       g.66995
 CCCAGCGCCAACCTCCGGGGCAGGCATCCGGGTGGAGAGAGGACTTGTCCCTCGTGGGTG       c.840
 P  S  A  N  L  R  G  R  H  P  G  G  E  R  T  C  P  S  W  V         p.280

          .         .         .         .         | 08         .    g.67483
 GTGGTTCTTTATAGAAAAAATCGAAGCTTAGCAGCTCCTCGAGGCCCG | GGTTTGGTAAAG    c.900
 V  V  L  Y  R  K  N  R  S  L  A  A  P  R  G  P   | G  L  V  K      p.300
               different C-terminus isoform-1         F  G  K  G    p.230+4

          .         .         .         .         .         .       g.67543
 GCTCCAGTGTGGTGGCCTATGAAGGACAATCCTGGCACGACTACTGCTTCCACTGCAAAA       c.960
 A  P  V  W  W  P  M  K  D  N  P  G  T  T  T  A  S  T  A  K         p.320

          .                                                         g.67555
 AATGCTCCGTGA                                                       c.972
 N  A  P  X                                                         p.323

          .         .         .         .         .         .       g.67615
 atctggccaacaagcgctttgttttccaccaggagcaagtgtattgtcccgactgtgcca       c.*60

          .         .         .         .         .         .       g.67675
 aaaagctgtaaactgacaggggctcctgtcctgtaaaatggcatttgaatctcgttcttt       c.*120

          .         .         .         .         .         .       g.67735
 gtgtccttactttctgccctataccatcaataggggaagagtggtccttcccttctttaa       c.*180

          .         .         .         .         .         .       g.67795
 agttctccttccgtcttttctcccattttacagtattactcaaataagggcacacagtga       c.*240

          .         .         .         .         .         .       g.67855
 tcatattagcatttagcaaaaagcaaccctgcagcaaagtgaatttctgtccggctgcaa       c.*300

          .         .         .         .         .         .       g.67915
 tttaaaaatgaaaacttaggtagattgactcttctgcatgtttctcatagagcagaaaag       c.*360

          .         .         .         .         .         .       g.67975
 tgctaatcatttagccacttagtgatgtaagcaagaagcataggagataaaacccccact       c.*420

          .         .         .         .         .         .       g.68035
 gagatgcctctcatgcctcagctgggacccaccgtgtagacacacgacatgcaagagttg       c.*480

          .         .         .         .         .         .       g.68095
 cagcggctgctccaactcactgctcaccctcttctgtgagcaggaaaagaaccctactga       c.*540

          .         .         .         .         .         .       g.68155
 catgcatggtttaacttcctcatcagaactctgcccttccttctgttcttttgtgctttc       c.*600

          .         .         .         .         .         .       g.68215
 aaataactaacacgaacttccagaaaattaacatttgaacttagctgtaattctaaactg       c.*660

          .         .         .         .         .         .       g.68275
 acctttccccgtactaacgtttggtttccccgtgtggcatgttttctgagcgttcctact       c.*720

          .         .         .         .         .         .       g.68335
 ttaaagcatggaacatgcaggtgatttgggaagtgtagaaagacctgagaaaacgagcct       c.*780

          .         .         .         .         .         .       g.68395
 gtttcagaggaacatcgtcacaacgaatacttctggaagcttaacaaaactaaccctgct       c.*840

          .         .         .         .         .         .       g.68455
 gtcctttttattgtttttaattaatatttttgttttaattgatagcaaaatagtttatgg       c.*900

          .         .         .         .         .         .       g.68515
 gtttggaaacttgcatgaaaatattttagccccctcagatgttcctgcagtgctgaaatt       c.*960

          .         .         .         .         .         .       g.68575
 catcctacggaagtaaccgcaaaactctagagggggagttgagcaggcgccagggctgtc       c.*1020

          .         .         .         .         .         .       g.68635
 atcaacatggatatgacatttcacaacagtgactagttgaatcccttgtaacgtagtagt       c.*1080

          .         .         .         .         .         .       g.68695
 tgtctgctctttgtccatgtgttaatgaggactgcaaagtcccttctgttgtgattccta       c.*1140

          .         .         .         .         .         .       g.68755
 ggacttttcctcaagaggaaatctggatttccacctaccgcttacctgaaatgcaggatc       c.*1200

          .         .         .         .         .         .       g.68815
 acctacttactgtattctacattattatatgacatagtataatgagacaatatcaaaagt       c.*1260

          .         .         .         .         .         .       g.68875
 aaacatgtaatgacaatacatactaacattcttgtaggagtggttagagaagctgatgcc       c.*1320

          .         .         .         .         .         .       g.68935
 tcatttctacattctgtcattagctattatcatctaacgtttcagtgtatccttacagaa       c.*1380

          .         .                                               g.68960
 ataaagcagcatatgaataacctgc                                          c.*1405

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Four and a Half LIM domains 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVDv.2.0-23 Build 23
©2004-2009 Leiden University Medical Center