Four and a Half LIM domains 1 (FHL1) - 428 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.67103
gtaagtgcacaccccacgaacagcccaagtttgcctcctggtggccactttgatgtcatg  c.888+60

         .         .         .         .         .         .  g.67163
gccctgacctaaatcaaagaaactggttatgctgggaggtcggtgcgcgtcacagggcaa  c.888+120

         .         .         .         .         .         .  g.67223
tagcgtggtggcatgggaacgtggggtctttacatcagggaagcccttggccgggcttca  c.888+180

         .         .         .      g.67257
gcatcttctcaggtccttgagagccacagcaggg  c.888+214

--------------------- middle of intron ---------------------
               g.67258        .         .         .           g.67291
               c.889-214  ttgcggcggcatgggggacaatggcggcgtgggg  c.889-181

.         .         .         .         .         .           g.67351
gactgtgcacgatggagtggaggagggggtctgggagccaggcagacctggctcttgcgt  c.889-121

.         .         .         .         .         .           g.67411
gcttgtcggtctgtgagtggggcaggtcgtcattttatctctctgaatcgtggtttcctc  c.889-61

.         .         .         .         .         .           g.67471
acctgtattcattcagctgtttctcttgttttcttttcttttctttttttttccccccag  c.889-1


Powered by LOVDv.2.0-23 Build 23
©2004-2009 Leiden University Medical Center