Four and a Half LIM domains 1 (FHL1) - 427 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.64249
gtaacgggcatccccatgtgccaatgggaagggctgggttttggagtgtcctttgcccac  c.156+60

         .         .         .         .         .         .  g.64309
aaccatggcagcagcagctggctgttaggatttcccagcatcactgcagccaccttgagg  c.156+120

         .         .         .         .         .         .  g.64369
cctcaaggaagcctcctccactccccaggccacagtggcccgagctgtttaatgtggggc  c.156+180

         .         .         .      g.64403
ttgactggatgggcgccagcgcccttgccagctc  c.156+214

--------------------- middle of intron ---------------------
                g.64404       .         .         .           g.64436
                c.157-213  ttttgattgcattctaaatatttcaagaattgt  c.157-181

.         .         .         .         .         .           g.64496
gagatttttatcctcacctcagcgtccctcctataagaatagtcactgtggggcagtccc  c.157-121

.         .         .         .         .         .           g.64556
aggtgtaagggactgtgtcatctcagtggtcagtcccagggaaatcagccttatgggagg  c.157-61

.         .         .         .         .         .           g.64616
gctcctgccaccacccccagcacccctcatggtggcccaccctgtctgcttggtttccag  c.157-1


Powered by LOVDv.2.0-23 Build 23
©2004-2009 Leiden University Medical Center