Leiden Muscular Dystrophy pages©

Dysferlin

(last modified November 26, 2004)

Contents

Summary

The genes for Limb-Girdle muscular dystrophy type 2B (LGMD-2B) and Myoshi myopathy (MM) were both mapped to human chromosome 2p12-p14 (Bashir, Bejaoui). Since two large inbred families were reported whose members include both MM and LGMD patients (Weiler, Illarioshkin), both diseases were suggested to arise from a similar gene defect, with the phenotype modified by additional factors. The gene behind the disease, designated the dysferlin gene (DYSF), was cloned simultaneously by Liu et al. (focusing on MM) and Bashir et al. (focusing on LGMD-2B) using a positional cloning approach. The gene contains over 55 exons and is transcribed in a 8.5 kb major transcript expressed strongly in skeletal muscle and heart (Liu). The mRNA encodes a 2,080 amino acid protein (Liu) of unknown function but with a significant homology to the nematode C. elegans spermatogenesis factor fer-1 (Liu, Bashir). Mutations in the dysferlin gene, predominantly truncating, were found in MM, LGMD-2B and DMAT patients (Liu, Bashir).

The dysferlin gene

Links to other databases:
Gene Symbol nomenclature    LocusLink    OMIM Gene Map   GDB

The human dysferlin gene (Gene Symbol DYSF, alternative symbols FER1L1, LGMD2B) was cloned simultaneously by Liu et al. (focusing on MM) and Bashir et al. (focusing on LGMD-2B) using a positional cloning approach. The gene maps to chromosome 2p13.1-p13.3, between markers D2S2443 and D2S291 (Bashir), telomeric to the beta-adducin gene. The gene is present in both a YAC- (Bashir, Bashir) and a PAC-contig (Liu); the 3' end of the DYSF-gene is present on PAC RPCI5-1031H12. Several EST's map within the candidate gene region (Bashir, Liu) of which one, TIGR-A004Z44 was strongly expressed in skeletal muscle, heart and placenta. TheDYSF-gene, spanning >150 kb (Aoki, Bashir), contains over 55 exons (Aoki, Liu) and contains several polymorphic intragenic (CA)n-repeat (104-sat). 

Exon Exon size
(bp)		 Intron size
(bp)		 5' cDNA
position		 Splice
after		 Remarks
1 >462 26,796 -376 1 5'UTR / 86 bp coding
2 56 940 89 0 intronic CA-repeat Cy172-H32
3 92 21,244 145 2
4 106 8,487 237 0
5 115 1,794 343 1
6 206 1,701 458 0
7 129 428 664 0
8 63 746 793 0
9 51 3,138 856 0
10 31 602 907 1
11 116 5,315 938 0
12 127 1,951 1054 1
13 104 6,619 1181 0
14 69 176 1285 0
15 44 3,845 1354 2
16 83 10,110 1399 1
17 42 1,649 1481 1
18 116 450 1523 0
19 114 1,226 1639 0
20 178 0.671 1753 1
21 125 2.049 1931 0
22 107 5,681 2056 2
23 193 3,113 2163 0
24 156 3,737 2356 0
25 132 89 2512 0
26 167 1,481 2644 2
27 115 294 2811 0
28 106 264 2926 1
29 143 3,456 3032 0 intronic CA-repeat 104SAT
30 174 15,233 3175 0
31 94 524 3349 1
32 78 8,275 3443 1
33 182 1.997 3521 0
34 141 0.767 3703 0
35 30 1.247 3844 0
36 30 8.370 3874 0
37 102 0.058 3904 0
38 162 1,014 4006 0
39 166 527 4168 1
40 77 30,554 4334 0 intronic CA-repeat
41 99 12,098 4411 0
42 129 2,558 4510 0
43 156 1.592 4639 0
44 92 3.531 4795 2 intronic CA-repeat
45 171 0.751 4887 2
46 143 2.072 5058 1
47 140 1,238 5201 0
48 89 269 5341 2
49 96 397 5430 2
50 142 4,450 5526 0
51 100 4,760 5668 1
52 179 1,765 5768 0
53 110 1.415 5947 2
54 148 3.775 6057 0
55 310 - 6205 - 3' CA-repeat

Legend:
Exon: numbering of exons and intron/exon boundaries are according to Aoki (2001) with the first base of the Met-codon counted as position 1 (see Reference Sequence). Exon size: size of exon indicated in basepairs. Intron size: size of intron indicated in kilobasepairs. 5' cDNA position: first base of the exon (according to cDNA sequence reported by Liu). Splice after: splicing occurs in between of two coding triplets (0), after the first (1) or the second (2) base of a triplet. Remarks: 5'UTR = 5' untranslated region, 3'UTR = 3' untranslated region, C2 = C2 domain, TMR = transmembrane region.

primers for DNA-amplification

The dysferlin mRNA

Links to other databases: UniGene: Hs.143897   RefSeq: NM_003494

A strong dysferlin RNA expression was detected in skeletal muscle, heart and placenta and a weaker expression in brain, kidney and lung and even weaker in liver and pancreas. On Northern blot, the major transcript measured about 8.5 kb (Liu, 7 kb according to Bashir - the largest reported cDNA sequence spans 6.9 kb [GenBank AF075575]). In brain the major transcript was 3.8 kb, showing highest expression in putamen and no expression in spinal cord and fetal brain (Bashir). The 8.5 kb transcript was present in cerebellum and medulla, with the 3.8 kb band much weaker in these tissues.

primers for RNA-amplification

The dysferlin protein

Links to other databases:   RefSeq: NP_003485

The dysferlin cDNA sequence contains a 6,243 bp open reading frame, encoding a putative 2,080 amino acid protein (Liu). It contains an extensive, highly charged hydrophilic region and a single predicted membrane-spanning region (aa 2047-2064), located close to the C-terminus. A membrane retention sequence, downstream of the trans-membrane region, indicates that dysferlin might be targeted to the endoplasmic or sarcoplasmic reticulum, with the N-terminus and most of the protein in the cytoplasm (Liu). The cytoplasmic domain contains several putative nuclear membrane targeting sequences (Liu) and four motifs which are homologous to C2-domains (aa 32-82, 431-475, 1160-1241 and 1582-1660). C2-domains often arise in approximately homologous pairs (double C2 or DOC2 domains) and are often able to bind Calcium, thereby initiating signalling events such as membrane fusion (Liu). The C2-domains in dysferlin are considerably shorter than typical domains and they are more widely separated.

Human dysferlin shows homology to the C.elegans spermatogenesis factor fer-1 (27% identity, 57% similarity)  (Liu). Known fer-1 mutations, all missense near the C-terminus, result in defective membrane organelle fusion and infertile spermatozoa. In human, there is no evidence for reduced fertility in male patients.

Dysferlin antibodies

Similarity to other proteins

Human and mouse dysferlin are ..% identical.....

Dysferlin and disease: LGMD-2B, MM, DMAT

Links to other databases:   OMIM: 603009

The genes for Limb-Girdle muscular dystrophy type 2B (LGMD-2B) and Myoshi myopathy (MM) were both mapped to human chromosome 2p12-p14 (Bashir, Bejaoui). Two large inbred families have been reported whose members include both MM and LGMD patients (Weiler, Illarioshkin), where both diseases map to the same genetic interval and where MM and LGMD-2B patients share the same haplotype. This suggested that both diseases arise from a defect in one gene, with the patient phenotype modified by additional factors.

Liu et al. (1998) and Bashir et al. (1998) identified mutations in both alleles of a gene, designated "dysferlin" (gene symbol DYSF), upon screening patients from families with MM and LGMD-2B resp. Six of the nine mutations initially identified by Liu et al. were predicted to cause truncation of dysferlin (2 nonsense, 3 frameshift and one splice mutation), while three were missense. In one of these families, both MM and LGMD patients were present. Liu et al. also reported a dysferlin mutation in a family with distal myopathy with anterior tibial onset (DMAT). Bashir et al. reported two mutations, both causing premature translation termination. One homozygous LGMD "founder" mutation (NOTE: no common ancestry could be demonstrated) was present in eight Libyan Jewish families, probably all coming from villages around Tripoli.

...Clinical features of the patients.  

dysferlin sequence variations - mutations and polymorphisms

Miscellaneous

DNA-primers

RNA-primers

Polymorphic repeats

An intragenic microsatellite marker, 104-sat, (Bashir) can be amplified using the primers 5'-aggaatgagattaatccgtgtg-3' and 5'-gggaaaattctatgagtgttgc-3'. The expected product is 156 bp, and analysis of 92 control European chromosomes detected five alleles at frequencies of: 152 bp, 0.02; 154 bp, 0.19; 156 bp, 0.63; 158 bp, 0.14; 160 bp, 0.02 (Bashir).

Liu reports 5 new markers spanning the MM/LGMD2B region, varying in heterozygosity from 0.82 to 0.32, of which one (Cy172-H32) is localized in intron 2 of the DYSF gene. The genomic sequence indicates the presence of additional CA-repeats.

Name Forward Reverse Size Repeat Alleles Het. Ta
PAC3-H52 GATCTAACCCTGCTGCTCACC CTGGTGTGTTGCAGAGCGCTG 138 CA 10 0.82 57
Cy172-H32 CCTCTCTTCTGCTGTCTTCAG TGTGTCTGGTTCACCTTCGTG 199 CCAT 7 0.72 56
PAC35-PH2 TCCAAATAGAAATGCCTGAAC AGGTATCACCTCCAAGTGTTG 161 CAT 5 0.30 56
PAC16-H41 TACCAGCTTCAGAGCTCCCTG TTGATCAGGGTGCTCTTGG 280 complex 4 0.41 58
Cy7-PH3 GGAGAATTGCTTGAACCCAG TGGCTAATGATGTTGAACATTT 211 AAGG 4 0.32 56

Legend:
Name: name of marker. Forward: sequence of forward primer. Reverse: sequence of reverse primer. Size: length of amplification product (in bp) on PAC-clone. Repeat: sequence of amplified repeat. Alleles: number of alleles found. Het.: heterozygosity index. Ta: annealing temperature (in oC).

Dysferlin sequences

|  Top of page | LMDp homepage |
| DMD/BMD + LGMD mutation databases |
| Remarks / information | Copyright©, liability |