Leiden Muscular Dystrophy pages

Primers for DYSF analysis

(last modified Febuary 04, 2004)



DNA-primers

ExonLength
(in bp)
Forward / reverse primerNameReferenceTm
(oC)
1203gacccacaagcggcgcctcggF408Aoki53
gaccccggcgagggtggtcggR4101
2193tgtctctccattctcccttttgtgF4111Aoki53
aggacactgctgagaaggcacctcR4111
3228agtgccctggtggcacgaaggF3262Aoki56
cctacctgcaccttcaagccatggR3261
3TCTCTTCTCCTAGAGGGCCATAG Liu
CTGTTCCTCCCCATCGTCTCATGG
4 cagaagagccagggtgccttaggF3251Aoki53
ccttggaccttaacctggcagaggR3251
5211cgaggccagcgcaccaacctgF3242Aoki56
actgccggccattcttgctgggR3242
6276ccaggcctcattagggccctcF3231Aoki56
ctgaagaggagcctggggtcagR3231
7165ctgagatttctgactcttggggtgF3222Aoki53
aaggttctgccctcatgccccatgR3211
8 ctggcctgagggatcagcaggF3561Aoki53
gtgcatacatacagcccacggagR3561
9 gagctattgggttggccgtgtgggF3551Aoki56
accaacacggagaagtgagaactgR3552
10138ccacactttatttaacgctttggcggF3201Aoki53
cagaaccaaaatgcaaggatacggR3201
11 cttctgattctgggatcaccaaaggF3191Aoki53
ggaccgtaaggaagacccagggF3191
12209cctgtgctcaggagcgcatgaaggF3181Aoki53
gcagacctcccacccaagggcgR3181
13217gagacagatgggggacagtcagggF3171Aoki53
cctcccgagagaaccctcctgR3171
14 gggagcccagagtccccatggF3161Aoki53
gggcctccttgggtttgctggR3161
15 gcctccccagcatcctgccggF3541Aoki53
tcactgagccgaatgaaactgaggR3541
16 tgtggcctgagttcctttcctgtgF3531Aoki56
ggtcaaagggcagaacgaagagggR3531
17 cccgtccttctcccagccatgF3151Aoki53
ctcccctggttgtccccaaggR3151
18 cgacccctctgattgccacttgtgF3141Aoki53
ggcatcctgcccttgccagggR3141
19 tctgtctcccctgctccttgF3522Aoki53
cttccctgccccgacgcccagR3522
20277gctcctcccgtgaccctctggF3121Aoki56
gggtcccagccaggagcactgR3121
20GCTCCTCCCGTGACCCTCTG Liu
GGGTCCCAGCCAGGAGCACTG
21276cagcgctcaggcccgtctctcF3111Aoki53
tgcataggcatgtgcagctttgggR3111
22 catgcaccctctgccctgtggF3512Aoki60
agttgagccaggagaggtgggR3512
23208catcaggcgcattccatctgtccgF3101Aoki56
agcaggagagcagaagaagaaaggR3091
24292gtgtgtcaccatccccaccccgF3082Aoki56
caagagatgggagaaaggccttatgR3082
25232ctgggacatccggatcctgaaggF3073Aoki56
tccaggtagtgggaggcagaggR3073
26234tcccactacctggagctgccttggF3061Aoki56
ggctctccccagccctccctgR3051
27 cagagcagcagagactctgaccagF3601Aoki56
tagaccccacctgcccctgagR3601
28 tcctctcattgcttgcctgttcggF3501Aoki56
ttgagagcttgccggggatggR3501
29212aagtgccaagcaatgagtgaccggF3031Aoki56
ctcactcccacccaccacctgR3021
30 cccaccggcctctgagtctgcF3011Aoki53
accctacccaagccaggacaagtgR3001
31 gaatctgccataaccagcttcgtgF2141Aoki56
tatcaccccatagaggcctcgaagR2141
32 cagccactcactctggcacctctgF2981Aoki56
agcccacagtctctgactctcctgR2981
33278acatctctcagggtccctgctgtgF2131Aoki56
cctgtgaggggacgaggcaggR2211
34 gccctgggtaagggatgctgattcF2202Aoki56
cctgcctgggcctcctggatcR2202
35 gagggtgatgggggccttaggF2111Aoki56
gcaatcagtttgaagaaggaaaggR2112
36 cccctctcaccatctcctgatgtgF2102Aoki60
ggcttcaccttccctctacctcggR2111
36CCCCTCTCACCATCTCCTGATGTG Liu
TGGCTTCACCTTCCCTCTACCTCGG
37 cacctttgtctccattctacctgcF2101Aoki56
ctcccagcccccacgcccaggR2101
38224ctgagccactctcctcattctgtgF2091Aoki60
tggaaggggacagtagggaggR2091
39 ggccagtgcgttcttcctcctcF2081Aoki56
tccctgacctgcccatcatctcR2071
40 gcccctgtcaggcctggatggF2061Aoki56
tgacccaggcctccctggaggR2061
41 ctgaaatggtctctttctttctacF2051Aoki50
cacaccgactgtcagactgaagagR2051
42297ttgtcccctcctctaatccccatgF2041Aoki60
gggttagggacgtcttcgaggR2041
43 cagccaaaccatatcaacaatgF2031Aoki56
ctggggaggtgagggctctagR2021
44178gaagtgttttgtctcctcctcF2011Aoki56
actagactgtgggttatcctgtR2011
45388a tcgagctcttgtcctgccCtgc McNally
cattggactcaatgagagaatg  
45231gggtgccctgtgttggctgacF1021Aoki56
gcaggcagccagcccccatcR1031
46227ctcgtctatgtcttgtgcttgctcF1041Aoki60
caccatggtttggggtcatgtggR1051
47283tctcgcttccccagctcctgcF1061Aoki56
tctggagttcgaggactctgggR1061
48 agaagggtggggagagaacggF1071Aoki56
cagctcagagcctgtggctggR1071
49286aaggccttcccatcctttggtaggF1082Aoki60
acaacccagagggagcacgggR1082
49TCCTTTGGTAGGAAATCTAGGTGG Liu
GGAAGCTGGACAGGCAAGAGG
50272gttgacgatgtatatactgtgttggF1092Aoki56
gctggcaccacagggaatcggR1091
50ATATACTGTGTTGGAAATCTTAATGAG Liu
GCTGGCACCACAGGGAATCGG
51 gcctctctctaactttgcttccttgF1102Aoki56
agcccccatgtgcagaatgggR1101
51CTTTGCTTCCTTGCATCCTTCTCTG Liu
AGCCCCCATGTGCAGAATGGG
52218ggctacaggctggcagtgatcgagF1112Aoki56
ttcccccatgccctccactggR1112
52GGCAGTGATCGAGAAACCCGG Liu
CATGCCCTCCACTGGGGCTGG
53211agccttcgtgcccctaaccaagtgF1121Aoki56
ctgtgggcattggggctcaggR1121
54281ggatgcccagttgactccgggF1141Aoki56
ccccaccacagtgtcgtcaggR1141
54GGATGCCCAGTTGACTCCGGG Liu
CCCCACCACAGTGTCGTCAGG
55216gccccagtgggatcaccatgF1151Aoki56
atgctggaggggaccccacggR116

Legend:
a Reported as tcgagctcttgtcctgccAtgc by McNally but this does not match with the genomic DYSF sequence.
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and added primer tails in italics - not yet verified). Exon: exon amplified. Numbering of exons is according to Aoki et al [2001]. Length (in bp): length of PCR-product in basepairs. Forward / reverse primer: sequence of forward and reverse primer. Reference: publication describing the primer(s). Name: name of the primers. Tm (oC): annealing temperature of the primer.


RNA-primers


PCR conditions Aoki et al. (2001)

First round RT-PCR2nd round PCRLocationLength
(in bp)
Forward / reverse primerNameReference
VII-84-9421027GACCCACAAGCGGCGCCTCGGF408Aoki
CGTGCCGGGGCTCTCTGTAAATGGR320 
VII-29GGGATCAAAAGAAAGCGAAGTGCGF323 
CCTCGGGGAGTTCCGGATGGAR355 
VII-30GTCCTACACACCGCTGCCTGGF325 
TGACAGCAGCTTTCTAGATGTAGGR3235 
VII-31AAGAACAGCGTGAACCCTGTATGGF411 
GGAGGGCTCCAGAGGAGTAGGR3245 
VII-32CCTTTCCGAGCCCTCTTTGCGF409 
CTGTTCCTCCCCATCGTCTCATGGR326 
VI697-17621066CGGGGGTGAACATCAAGCCTGTGGF322Aoki
CTAAGGTACTTCTCCACCCGGAGGR313 
VI-26CCCTCCATGTGCGAAAAAATGAGGF354 
TGCCTGTGTTGAGCTCTGTGTAGGR314 
VI-27TGAAGGTCTTCCGGGCCGAGGF318 
TTTTCGACATACTCAGGTAGGTGGR353 
VI-28GTGGTAGACTCTCGTTCTCTCAGGF355 
TCTGTTTCACGTTGTCCATCACGGR317 
V1356-25491193CCCTCCATGTGCGAAAAAATGAGGF354Aoki
CACTGGCATCCGGGCGCCAGGR307 
V-22GACGGATGAGCTCATCGCAGGF310 
GCACCCCGCCGGGAGAAGAGGR308 
V-23GGGGTAACGTGAAACCTGTGGTGGF311 
TGGGTGGCAGAGGGTGTCTCATGGR310 
V-24GCGCAAGTACTCCCTGTTTGCGGF312 
CGGTCAGCAATCCCAAGCAGCTGGR311 
V-25TGGCAGTCCCAGAGAGTTCACAGGF314 
TGGAGGCCAGCGGCAGGCAGGR312 
  exon 21-24575GCCACTACTACTACCTACCC /
TCAGAAAGATTGTCTGTAGCTTC
DYSF-E28F /
DYSF-E31R
McNally
IV2404-35521149AGCGTGTGGCATACCAGCGGGF308Aoki
TCTGGTGCAGGAAGGAGACGATGGR213 
IV-17AAGATGTACTACACACACCGACGGF302 
AGCTCAAGGTGGAGACGGACATGGR215 
IV-18CCGGTCACCTGAGCTTCGTGGF370 
TGCCTTTTCAGTGCTTCCATTTGGR3025 
IV-19CGGGCAAGATCAAGCTACCCAAGGF306 
GTAGATCCACTGGCCTCCGGGR360 
IV-20GTGCAGATACGGGTCAAGCTGTGGF307 
ACACGAACCAATCTCCAGCCCAGGR305 
IV-21GGCATACCAGCGGGTGCCCGF3085 
GACAGCTTCCCCTCAGCAAACTGGR3076 
III3283-44051123GCCGTCGCATGGAGCCACTGGF300Aoki
ATGGGGATGAGGGGCTCCTTGR206 
III-10ACGGTGCAGTCCTGTGTCATCAGGF209 
ATGGGGATGAGGGGCTCCTTGR206 
III-11CCCTACCCACCACCCCAGAGGF210 
GGTTATCGATGACCTTGACGGTGR208 
III-12TGTCAACCGAGTCTGGAACGGATGF220 
CGCTGGCTTGATGTTCTGAGGR210 
III-14AGATCGAGATCTTTGGCGAGCCGGF221 
AGCAGCTCCCCCGACGGCTGGR220 
III-15ATCTACGCTGCTACATGTACCAGGF298 
GTACAGCTCCACCACAATGCTGGGR221 
III-16CTGCAGCTGTGTTTGCCCTTGAGGF299 
TCTGGTGCAGGAAGGAGACGATGGR213 
II4334-5303960CGATGTGAGCCTACTCAGTCCTGGF206Aoki
CCGTGACTCCACGTGCTCCGGR106 
II-6TGTCCAAGTTTGGGGCTCGCTGTGF103 
CCTGCTGCTGAAGCACATGCAGAGR1065 
II-7GCAGCCCAAGGACCCCAATGGF202 
AGCTGGGAGGGGCGGAGCTGGR104 
II-8CACACAGCTGGAGAATGTGGAGGF2046 
GTGCAGGGGATGTAGTTATCCTGGR101 
II-9CGATGTGAGCCTACTCAGTCCTGGF206 
  TCTTGCCCCGGTACAGCTTGAAGGR204 
  exon 44-47392CTGCACGCTGGAGCCCGTAT /
GCCAGACGCTCCTCCACTGG
Fer1F3 /
Fer1R4
McNally
I5218-63171100ACCCACACCTGGGCCCAGTGGF106Aoki
GAGCTGGGCGGAGGAGGCAGGR117 
I-1CCCGACACCTCCTTCCTGTGGF113 
ATGCTGGAGGGGACCCCACGGR116 
I-2TGCCCAAGCCAGCCAAGACAGF1115 
ACGCCGCCACAGGATGAACTTR12 
I-3GGAGGTGAAGGCAACTTCAACTGGF109 
AAAAGGGACACAAACCATTCTGGGR111 
I-4CGAAGGCCCTGGGGCGGCCTGGF107 
GTACAGACTTGCTCAGCTGGCAGGR109 
I-5 CTCTGCATGTGCTTCAGCAGCAGGF1065 
TCGCTCATCTTCTCCCCCGTGAGGR108 

Legend:
First round RT-PCR / 2nd round PCR: RT-PCR sets described by Aoki et al. [2001]. Location: position of primer sequences in relation to the DYSF-cDNA Reference Sequence. Numbering of exons is according to Aoki et al. [2001]. Length (in bp): length of amplified segment in base pairs. Forward / reverse primer: sequence of forward and reverse primer. Name: name of the primers. Reference: publication describing the primer(s).


 PCR conditions Ueyama et al. (2001)

RT-PCR
set
LocationLength
(in bp)
Forward / reverse primer
A-262-827966GCCAGGAGCCAGAGATTC
TCCCCAGGAGAGTCAAAC
B599-1538940TCAAAAGAAAGCGAAGTG
CCCAGGTAGTCATCCAAG
C1462-1848387CCTGGAGGAGAAATAGAA
GCTGACCTCAAACTGGAT
D1785-2534750TGCGGCCTTCTACTCAGC
CCAGGCACCTTCTCCATC
E2484-3437954TGGGAAGCTACAGACAAT
AATATGCAGGAAATCGTG
F3152-4091940GCCAAATGGAAGCACTGA
TGGCCCCCACACTCTACC
G3768-4482715CTGGTTCCCACTGACGAG
GTAGGAGCCGCACTTTTC
H4456-5418963GGGGAGAGGGAAAAGTGC
CCGTGGGGTGATGTTGAA
I5119-5766648CAGCAGCATAGAGTCAAG
CAGAAAATCATCAAAGGA
J5729-6450722TCTGGGACAATGACAAGT
GAGAAGGAAATGATGGAA

Legend:
RT-PCR set: RT-PCR sets described by Ueyama et al. [2001]. Location: position of primer sequences in relation to the DYSF-cDNA Reference Sequence (NOTE: location nor sequence has been verified yet). Numbering of exons is according to Aoki et al. [2001]. Length (in bp): length of amplified segment in base pairs. Forward / reverse primer: sequence of forward and reverse primer. 



Top of page | LMDp homepage |
| DYSF homepage | DYSF sequence varaints |
| Remarks / information | Copyright, liability |