(last modified January 6, 2006)
This page gives an overview of the markers that have been described in and directly flanking the DMD gene, including RFLP (Restriction Fragment Length Polymorphism) and VNTR (Variable Number of Tandem Repeats, CA-repeats); for details regarding their localization, see "Sequences / markers in and around the dystrophin gene" . These markers can be used for mapping studies (linkage, association) in relation to DMD/BMD and the DMD-gene. Rarely, these markers are used these to screen carriers for deletions.
Probe name | Repeat | DXS nr. (UniSTS-link) |
GDB- link |
Localization in DMD gene | Reference | Length (in bp) |
Alleles | PIC/HF | Primer name |
Forward / reverse primer |
---|---|---|---|---|---|---|---|---|---|---|
5'DYS-III | c.-140132 (TA)8(CA)10 |
5' Dp427c promoter | Feener (1991) | 4 | 0.59 | ttttttaggtataacttacatacaataaacc / gtgacaataagcatatcagtggctgcc |
||||
5'DYS-I | c.-132222 (TG)6(TA)10 |
5' Dp427c promoter | Feener (1991) | 5 | 0.61 | actgtaaatgaaattgttttctaagtgcc / cttaacaaaatgtccttcagttctatcc |
||||
5'DYS-II / sWXD2450 | -129241 (CA)15 |
DXS1242 | DXS1242 | 5' Dp427c promoter | Feener (1991) | 206 | 8 | 0.77 | tcttgatatatagggattatttgtgtttgttatac / attatgaaactataaggaataactcatttagc |
|
5'DYS-IV | c.-123974 (TG)5(TA)4 |
Dp427c intron 1 | Feener (1991) | 0 | 0 | aaacaaagtaatattgttagacatgtatcc / gttaaggttcctcttagatcatggtgtcc |
||||
5'DYS MSB / sWXD2452 | c.-8043 (AC)16_30 |
intron 1c | Oudet (1991) | 97 | 6 | 0.25 | OA34/ OA35 |
atggttgatactttagagattattg / gtgtcaagtaaaatttatttacagc |
||
5'DYS MSA = 5'-5n1 |
c.31+15515 (AC)8_24 |
DXS1243 | DXS1243 | intron 1m | Oudet (1991) | 74 | 10 | 0.57 | NM72/ NM73 |
atcccatcctgttctatttt / actggcatgcattattttgt |
King (1995) | 198 | cacgacagattatatgagtcat / aagccttatgaatactggcat |
||||||||
5'-5n3 | (TG)23 | intron 2 | King (1994), King (1995) | 112 | 9 | 0.76 | ttcagtttctctcggtgttcct / tacacctgcacatgtgatgaaa |
|||
5'-5n4 | (AC)24 | intron 4 | King (1995) | 133 | 8 | 0.64 | gaagggaaaatgatgaataaaact / gtcagaactttgtcacctgtc |
|||
DMDSTR07A | (TC)5TT(CT)12(CA)17 | (DXS206) | intron 7 | DB: Leiden | 226 | 12 | 0.68 | ttctggttttctggtctg / gaatcaatctctctgtcaag |
||
DMDSTR07B | (AC)18 | (DXS206) | intron 7 | DB: Leiden | 231 | 7 | 0.44 | agctattatctgagaaagtc / tgaggtgaatttattaaggg |
||
5'-7n4 | (CA)8TA(CA)19 | intron 25 | King (1995) | 165 | 4 | 0.52 | gtgaagctacaaaaatattagag / caacaatatctcaccatacttg |
|||
STR-44 | (TG)6GG(TG)15 TA(TG)2(AG)14 |
DXS1238 | DXS1238 | intron 44 | Clemens (1991) | 196 | 12 | 0.86 | tccaacattggaaatcacatttcaa / tcatcacaaatagatgtttcacag |
|
IVS44SK12 | (GT)18 | intron 44 | Kochling (1995) | 181 | 5 | 0.38 | cctcagtgaatgaatagcacac / ttggtgaacagctccagaagg |
|||
IVS44SK21 | (GT)22 | intron 44 | Kochling (1995) | 165 | 10 | 0.87 | ggtttgctgaacagctccag / gctcagtgaatgaatagcacac |
|||
AFM297yd1 | (GT)13 | DXS1219 | DXS1219 | intron 44 | Dib (1996), DB: Leiden | 8 | 0.59 | ttaatgtttcanccaggtaaat / gatcactccaaaggatagattgt |
||
P20-CA | complex (TC)11(TG)10 |
DXS269 | intron 44 | DB: Köchling, DB: Leiden | 246 | >0.80 | aggggaggtacagcatttct / cacttgtctctgccacaaca |
|||
STR-45 (.1) | (CA)28 | DXS1237 | DXS1237 | intron 45 | Clemens (1991) | 172 | 13 | 0.89 | gaggctataattctttaactttggc / ctctttccctctttattcatgttac |
|
STR-45.2 | (AC)15 | intron 45 | DB: Chamberlain | |||||||
AFM217xa5 | (GT)15 | DXS997 | DXS997 | intron 48 | Dib (1996) | 4 | 0.7 | tggctttattttaagaggac / gttttcagtttcctgggt |
||
STR-48 | (GT)18 | intron 48 | DB: Chamberlain | |||||||
STR-49 | (AC)24 | DXS1236 | DXS1236 | intron 49 | Clemens (1991) | 249 | 19 | 0.93 | cgtttaccagctcaaaatctcaac / catatgatacgattcgtgttttgc |
|
STR-50 = AFM234vg7 |
complex (CA)16 |
DXS1235 | DXS1235 | intron 50 | Clemens (1991) | 241 | 6 | 0.72 | aaggttcctccagtaacagatttgg / tatgctacatagtatgtcctcagac |
|
DXS1067 | DXS1067 | Dib (1996) | 6 | 0.6 | tatgtcctcagactattcagatgcc / cctccagtaacagatttgggtg |
|||||
AFM072zh3 | (GT)13 | DXS1036 | DXS1036 | intron 51 | Dib (1996) | 6 | 0.73 | tgcagtttattatgtttccacg / gccattgataagtgccagat |
||
DMD1-2c / DMD I | (GT)17 | DXS1241 | DXS1241 | intron 59 | Powell (1991) | 251 | 5 | 0.51 | tgtctgtcttcagttatatg / ataacttacccaagtcatgt |
|
J66 | complex [(TA)n(TG)n]n | (DXS268) | intron 60 | Yau et al (unpublished) | ~1.1 kb | 0.57 | gcagctatatgtttcccaagattga / gaggttctttggaggaatac |
|||
DI623 | 9225-23589_9225-23542 (GAA)9_27 |
intron 62 | Matsumoto (2004) | 141-195 | 18 | 0.91 | acctgcctagtcaaggta / cactgccatggtgaatGatc* |
|||
STR62/63 | (AC)15 | intron 63 | Taylor et al. (unpublished) | ~190-200 | 0.38 | ttcttcgtcgatacccccattcca / ctctttgagtttaaagttacctga |
||||
AFM283wg9 | c.9286+18221_9286+18254 (CA)16-21 |
DXS1214 | DXS1214 | intron 63 | Dib (1996) | 7 | 0.78 | tagaacccaaatgacaacca / aagatagcaggcaacaataaga |
||
DI671 | c.9808-4883_9808-4814 (CT)17_36 |
intron 67 | Matsumoto (2004) | 239-277 | 14 | 0.81 | tcgccccttcagaagtcact / gtccagcagatcaatcgtccagc |
|||
3'DYS MSC | c.*461(CA)8 (TACA)1_2(CA)6 |
DXS1234 | DXS1234 | exon 79 (11,550) | Oudet
(1990), Beggs
(1990), Matsumoto (2004) |
133 | 5 | 0.34 | gaaagattgtaaactaaagtgtgc / ggatgcaaaacaatgcgctgcctc OR gttgtttataaaaacccctaaaaacaaaac / ggatgcaaaacaatgcgctgcctca OR TGGAACGCATTTTGGGTTGT / AACAATGCGCTGCCTCAAAG |
|
MP1S | c.*942_*956 (AAGTA)2_3 |
exon 79 | Roberts (1989) | 995 | 2 | ? | MP15/ MP13 |
aagtcgacGGCTTACCTGCTTGGTCTAG / atatcgatGTCAGAGGTAACAGATTTGC |
||
MP1P | c.*1033_1052 (TGAT)5_6 |
DXS503 | DXS503 | exon 79 | Abbs (1990), Roberts (1989) | 69 | 4 | 0.22 | MP1P5/ MP1P3 |
atgATCAGAGTGAGTAATCGGTTGG / atatcgatCTAGCAGCAGGAAGCTGAATG |
MP1Q | c.*1554_*1565 (TAAG)3_4 |
exon 79 | Abbs (1990), Roberts (1989) | 63 | 2 | 0.08 | MP1Q5/ MP1Q3 |
GCGAGTAGTTCCACACAGGTTTG / GTAACATTTGAATCAATTTGCC |
||
3'-19n8 | (GT)18 | 200 kb 3' of exon 79 |
King (1994), King (1995) | 148 | 5 | 0.58 | aacgacttcccccactctgt / agccccattctgtacatcaaat |
|||
AFM184xg5 | DXS992 | DXS992 | >200 kb 3' of exon 79 |
DB: Leiden | 11 | 0.87 | aagaatgggactccatttca / gcttatccactgggacagaa |
|||
AFM112xf2 | DXS985 | DXS985 | >200 kb 3' of exon 79 |
Dib (1996), DB: Leiden | 5 | 0.61 | tttccaaacttcactaaaac / aaaatgttgttgtactggtc |
Matsumoto et al. (2004) describe 11 additional polymorphic makers from 25 kb to 220 kb 3 'of the dystrophin stop codon.
Legend:
Probe name: name of probe, with link to local details (when available). Repeat:
type of VNTR-repeat sequence. DXS nr. (UniSTS-link): DXS numberwith
link to UniSTS
database at NCBI. GenBank: DXS-number with link to the Genome
DataBase (GDB). Localization in DMD gene: physical localization of
marker in relation to the DMD gene (see Sequences / markers in and around the dystrophin gene). Reference: reference
describing marker, "DB: ..." indicating a direct submission to these pages by
the group indicated. Length (in bp): length of the allele in the Genomic
Reference Sequence of the DMD-gene. Alleles:
number of different alleles observed. PIC/HF: PIC-value / heterozygosity frequency.
Primer name: name of the primers. Forward / reverse primer:
sequence of the forward and reverse primers (5' to 3').
*C in paper, G in genome sequence.
Marker | DXS-number (GDB-link) |
Location | Reference | Lengt(in bp) | PIC/HF | Forward / reverse primer |
---|---|---|---|---|---|---|
pERT84-1 / MaeIII | DXS142 (in GDB) |
intron 1m (L37425) |
Roberts (1989) | 254 / 128+108 | 0.38 | cagggatgcaaaggaactggg / cagtttgtttaacagtcactc |
pERT 87-1 / BstNI | DXS164 (in GDB) |
intron 12 | Roberts (1989) | 418 / 250+150 | 0.45 | ctatcatgcctttgacattccag / ctcaataagagttggattcattc |
pERT87-8 / TaqI | DXS164 (in GDB) |
intron 13 (L05531) |
Roberts (1989) | 145 / 74+71 | 0.38 | gtcagttggtcagtaaaagcc / ccaattaaaaccacagcag |
pERT87-15 / TaqI | DXS164 (in GDB) |
intron 16 (L05532) |
Roberts (1989) | 415 / 231+184 | 0.44 | gactttcgatgttgagattactttccc / aagcttgagatgctctcaccttttcc |
pERT87-15 / BamHI | DXS164 (in GDB) |
intron 17 (L05532) |
Roberts (1989) | 216 / 166+50 | 0.47 | tccagtaacggaaagtgc / ataattctgaatagtcacaaaaag |
pERT87-15 / XmnI | DXS164 (in GDB) |
intron 17 (L05532) |
Roberts (1989) | 689 / 479+210 |
0.44 |
acaatttccctttcattccag / gactggagcaagggtcgcc |
Legend:
Marker: name of probe (marker). DXS nr. (GDB-link): DXS number
with link to UniSTS
database at NCBI and the Genome DataBase (GDB).
Location: physical localization of marker in relation to the DMD gene
(see Sequences / markers in and around the dystrophin
gene). Reference: reference describing marker, "DB:
..." indicating a direct submission to these pages by the group indicated. Length
(in bp): length of the allele in the Genomic
Reference Sequence of the DMD-gene; italics = data not checked. PIC/HF: PIC-value /
heterozygosity frequency. Primer name: name of the primers. Forward /
reverse primer: sequence of the forward and reverse primers (5' to 3').
| Top of page |
| LMDp homepage | Remarks /
information | Copyright©,
liability |