(last modified November 17, 2002)
zeta-Sarcoglycan (Gene Symbol SGCZ) was first discovered by Wheeler et al. (2002) as two ESTs showing strong similarity to gamma- and delta-sarcoglycan (rat BG664629 and mouse BB045304). The human gene maps to chromosome 8p22, contains 8 exons and spans over 465 kb. Kutchik et al. (WMS2002 meeting, abstract D.P.3.8 Neuromuscul.Disord. 12: 733) describe differential splicing of the SGCZ-gene with transcripts which lack either exon 3, exon 4 or both these exons. SGCZ is a 299 amino acid protein, encoding a typical sarcolgycan protein containing a hydrophobic cytoplasmic domain, followed by a transmembrane region and an extra-cellular C-terminal domain with a conserved site for asparagine-linked N-glycosolation (Asn110) and four conserved cysteine residues. Using antibody ZSG1, Wheeler et al. (2002) detected zeta-sarcoglycan in the plasma membrane of skeletal and cardiac muscle. Expression was also detected in the smooth muscle layer of coronary arteries, but not in the thin layer of the endothelial cells. Immunoprecipitation showed that SGCZ is bound to the sarcoglycan complex (Wheeler et al. 2002). Compared to controls, Sgcz is reduced in muscle of mdx-mice. Sgcz was slightly reduced resp. greatly reduced in the sarcolemma of homozygous Sgcg and Sgcd knock-out mice. In these mice, Sgcz staining was not reduced in vascular smooth muscle cells from rat thoracic aorta which also contained Sgcb, Sgcd but not Sgcg.
Links to other databases:
Gene
Symbol nomenclature LocusLink
zeta-Sarcoglycan (Gene Symbol SGCZ) was first discovered by Wheeler et al. (2002) as two ESTs showing stron similarity to gamma- and delta-sarcoglycan (rat BG664629 and mouse BB045304). Starting with this homology, primers for RT-PCR across the entire coding region were designed and used to amplify the murine Sgcz sequence from murine heart and skeletal muscle.
The human gene maps to chromosome 8p22, contains 8 exons and spans over 465 kb. Kutchik et al. (WMS2002 meeting, abstract D.P.3.8 Neuromuscul.Disord. 12: 733) describe differential splicing of the SGCZ-gene. Two alternative 5'-first exons were detected, designated 1A and 1B. In addition, transcripts were described which lack either exon 3, exon 4 or both these exons.
| Exon | Exon size (bp) | Intron size (bp) | 5' cDNA position | Splice after | Remarks |
|---|---|---|---|---|---|
| 1 | (?) | ? | - | - | 5'UTR |
| 2 | 195 | 200 kb | 1 | 0 | cytoplasmic (aa 1-37) domain and transmembrane region (aa 38-58) |
| 3 | 102 | 86,425 | 196 | 0 | diff. spliced |
| 4 | 88 | 72,891 | 298 | 1 | diff. spliced; asparagine-linked N-glycosolation site (Asn110) |
| 5 | 123 | 56,346 | 386 | 1 | |
| 6 | 73 | 5,665 | 509 | 2 | |
| 7 | 124 | 11,741 | 582 | 0 | four conserved Cys-residues; |
| 8 | 773 | - | 706 | - | 195 bp coding / 3'UTR |
Legend:
Exon: numbering of exons and intron/exon boundaries are according to
database analysis. Exon size: size of exon indicated in basepairs. Intron size:
size of intron indicated in kilobasepairs. 5' cDNA position: first base of the exon
(according to cDNA Reference Sequence with the first base of the Met-codon counted as position 1. Splice after: splicing occurs
in between of two coding triplets (0), after the first (1) or the second (2) base of a
triplet. Remarks: 5'UTR = 5' untranslated region, 3'UTR = 3' untranslated region,
N-Glyco = potential N-linked glycosylation site, Phos = putative serine phosphokinase C
phosphorylation site, TMR = transmembrane region.
Links to other databases: RefSeq: NM_139167
No reports on the size of zeta-sarcoglycan transcripts are available yet.
Links to other databases: RefSeq: NP_631906
zeta-Sarcoglycan is a 299 amino acid protein, encoding a typical sarcolgycan protein. The predicted molecular mass for SGCZ is ...kDa. At its N-terminus it contains a 37 amino acid hydrophobic cytoplasmic domain, followed by a 21 amino acid transmembrane region (Phe38-Leu58). The 241 amino acid extra-cellular C-terminal domain contains a conserved site for asparagine-linked N-glycosolation (Asn110) and four conserved cysteine residues (Cys271, Cys273, Cys289 and Cys296).
Using antibody ZSG1, Wheeler et al. (2002) detected zeta-sarcoglycan in the plasma membrane of skeletal and cardiac muscle. Expression was also detected in the smooth muscle layer of coronary arteries, but not in the thin layer of the endothelial cells. In skeletal muscle, SGCZ co-localised with dystrophin and concentrated at costamers, discrete sub-cellular structures that overlie Z-lines.
Immunoprecipitation of heavy microsomes using SGCB-antibodies showed that SGCZ is bound to the sarcoglycan complex (Wheeler et al. 2002). This association was not disrupted significantly in sarcoglycan mutant microsomes. ZSG1 antisera specifically precipitated dystrophin, indicating that SGCZ interacts with dystrophin. This interaction was not eliminated in microsomes of skeletal muscle of Sgcg and Sgcd knock-out mice.
Compared to controls, Sgcz is reduced in muscle of mdx-mice. Sgcz was slightly reduced resp. greatly reduced in heavy microsomes (contains the sarcolemma and sarcoglycan complex) of homozygous Sgcg and Sgcd knock-out mice. In these mice, Sgcz staining was not reduced in vascular smooth muscle cells from rat thoracic aorta which also contained Sgcb, Sgcd but not Sgcg.
Links to other databases:
Sofar, zeta-sarcolgycan has not been implicated in genetic disease.
Amplified |
Length |
Reference |
forward primer |
reverse primer |
Name |
|---|---|---|---|---|---|
Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and
added primer tails in italics. Amplified: region amplified. Numbering of exons is
according to .
Length: length of PCR-product in basepairs. Reference: publication
describing the primer(s). Forward primer: sequence of forward primer. Reverse
primer: sequence of reverse primer. Name: name of the primers.
Amplified |
Reference |
Length |
Forward primer / |
Name |
|---|---|---|---|---|
| exon 2-8 | Wheeler | 897 | ATGACTCGAGAACAATACATACTAGCCACACAGCA / TCAGTTCCACAAGCAAATGCTACTACTGGACTGAC |
mZSG-1F /900R |
Legend:
Primers for amplification of murine cDNA sequences. Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and
added primer tails in italics. Amplified: region amplified. Numbering of exons is
according to Wheeler
(2002).
Length: length of PCR-product in basepairs. Reference: publication
describing the primer(s). Forward primer: sequence of forward primer. Reverse
primer: sequence of reverse primer. Name: name of the primers.
| Top of page | LMDp homepage
|
| Sarcoglycan homepage | SGC-alpha, SGC-beta, SGC-gamma,
SGC-delta, SGC-epsilon
|
| Remarks / information | Disclaimer
|