Human and Clinical Genetics - Leiden University Medical Center

RetinoschisisDB©

PCR of the RS1-gene

(modified last: April 6, 2002)

Primer table

Exon Forward primer Reverse primer Product size (bp) Ta (ºC) MgCl2 (mM) Name Reference Technique PCR-conditions
1 ctcagccaaagacctaagaac gtatgcaatgaatgtcaatgg 216 58 1.5 rstu12-1f/1r DB: Berger, Sauer SSCA PCR-A
1 aagatgcttaatgaggccag [GC]gtatgcaatgaatgtcaatg 225 55   RSDGGE-1F/R DB: Leiden DGGE PCR-B
2 gtgatgctgttggatttctc caaagtgatagtcctctatg 176 56 1.5 rstu12-2f/2r DB: Berger, Sauer SSCA PCR-A
2 gcgcggagtgatgctgttggatttc [GC]gtcctctatgttattttggc 213 55   RSDGGE-2F/R DB: Leiden DGGE PCR-B
3 ctgccctgcctctctggttg ggtgttcccaatgactgttcc 178 60 1 rstu12-31f/3r DB: Berger, Sauer SSCA PCR-A
3 taaccgtaacttttctgccc [GC]tcccaatgactgttccatcc 227 55   RSDGGE-3F/R DB: Leiden DGGE PCR-B
4 ggtgcttgttgagtattgag aaaatccccgggccctgc 219 56 1.5 rstu12-f/tu12ex4-rev DB: Berger, Sauer SSCA PCR-A
4 [GC]tgagtattgagatatgtgtg cagtccacgaagaataccag 194 55   RSDGGE-4aF/R DB: Leiden DGGE PCR-B
4 accagatcacctgctctaac [GC]catgaaaaaaaatccccggg 161 55   RSDGGE-4bF/R DB: Leiden DGGE PCR-B
5 gagtctctcggtgactcggt gagctgaagttggtttggga 263 58 1.5 5f/r DB: Berger SSCA
5 gagagccagcacctgcgg gggtgcgagctgaagttgg   65   245638-f/r Sauer SSCA PCR-A
5 tttgcagacatgcacagggg [GC]tgcgagctgaagttggtttg 326 55   RSDGGE-5F/R DB: Leiden DGGE PCR-B
6 cccgatgtgatggtgacagg ctttgttctgactttctctggc   62   245263-f/r Sauer SSCA PCR-A
6 ccgatgtgatggtgacagg tgtgtgagggggtcccta 261 62 2.5 6f/r DB: Berger SSCA
6 cccgatgtgatggtgacagg aaatatagccctgtccatctc       245263-f/TO4471 DB: Franco, Sauer SSCA
6 [GC]tgtgatggtgacaggatttc tctgtgccagtcaccccctg 271 55   RSDGGE-6F/R DB: Leiden DGGE PCR-B

Legend

Exon: number of exon amplified (numbering acc. to Sauer et al.). Forward primer: sequence of forward primer. Reverse primer: sequence of reverse primer. Product size (bp): size of PCR-product generated, given in base pairs. Ta (ºC): annealing temperature used in PCR, in ºC. MgCl2 (mM): concentration of MgCl2 in PCR-reaction, given in miliMolar. Name: name of primers Reference: literature reference for primer sequence, DB = reported directly to the database by the person listed. Technique: technique used for mutation detection, DGGE = denaturing gradient gele-electrophoresis, SSCA = single-strand conformation analysis. PCR-conditions: conditions for the PCR reaction.
[GC] = GC-clamp (5'-cgcccgccgcgccccgcgcccggcccgccgccgcggccgc-3').

PCR conditions

PCR-A (from Sauer et al.)

  1. denaturation - 5 min 94ºC
  2. amplification - 30 cycles of 30 sec 94ºC / 30 sec Ta (see Table) / 30 sec 72ºC
  3. final extension - 5 min 72ºC

PCR-B (from Kraayenbrink)

PCR mix: 1* supertaqbuffer, 12.5 pmol of each primer, 600 uM dNTP's, 1.5mM extra MgCl2, 1.5 U AmpliTaq, 200 ng DNA (patient), 100 ng DNA (control).

PCR program: denaturation 3 min. 94ºC; 35 cycli of 45 sec. 94ºC / 45 sec 55ºC / 1 min 72ºC; final extension 7 min. 72ºC; denaturation 5 min. 94ºC; renaturation 10 min. 55ºC

PCR-fragments / DGGE-electrophoresis (at 58ºC):

Exon 1 2 3 4a 4b 5 6
product (bp) 225 213 227 194 161 326 271
calculated melting T (ºC) 73 67 76 73 76 75 79
melting % UF 47 28 56 47 56 53 66

| Top of page | RetinoschisisDB homepage |