(modified last: April 6, 2002)
| Exon | Forward primer | Reverse primer | Product size (bp) | Ta (ºC) | MgCl2 (mM) | Name | Reference | Technique | PCR-conditions |
|---|---|---|---|---|---|---|---|---|---|
| 1 | ctcagccaaagacctaagaac | gtatgcaatgaatgtcaatgg | 216 | 58 | 1.5 | rstu12-1f/1r | DB: Berger, Sauer | SSCA | PCR-A |
| 1 | aagatgcttaatgaggccag | [GC]gtatgcaatgaatgtcaatg | 225 | 55 | RSDGGE-1F/R | DB: Leiden | DGGE | PCR-B | |
| 2 | gtgatgctgttggatttctc | caaagtgatagtcctctatg | 176 | 56 | 1.5 | rstu12-2f/2r | DB: Berger, Sauer | SSCA | PCR-A |
| 2 | gcgcggagtgatgctgttggatttc | [GC]gtcctctatgttattttggc | 213 | 55 | RSDGGE-2F/R | DB: Leiden | DGGE | PCR-B | |
| 3 | ctgccctgcctctctggttg | ggtgttcccaatgactgttcc | 178 | 60 | 1 | rstu12-31f/3r | DB: Berger, Sauer | SSCA | PCR-A |
| 3 | taaccgtaacttttctgccc | [GC]tcccaatgactgttccatcc | 227 | 55 | RSDGGE-3F/R | DB: Leiden | DGGE | PCR-B | |
| 4 | ggtgcttgttgagtattgag | aaaatccccgggccctgc | 219 | 56 | 1.5 | rstu12-f/tu12ex4-rev | DB: Berger, Sauer | SSCA | PCR-A |
| 4 | [GC]tgagtattgagatatgtgtg | cagtccacgaagaataccag | 194 | 55 | RSDGGE-4aF/R | DB: Leiden | DGGE | PCR-B | |
| 4 | accagatcacctgctctaac | [GC]catgaaaaaaaatccccggg | 161 | 55 | RSDGGE-4bF/R | DB: Leiden | DGGE | PCR-B | |
| 5 | gagtctctcggtgactcggt | gagctgaagttggtttggga | 263 | 58 | 1.5 | 5f/r | DB: Berger | SSCA | |
| 5 | gagagccagcacctgcgg | gggtgcgagctgaagttgg | 65 | 245638-f/r | Sauer | SSCA | PCR-A | ||
| 5 | tttgcagacatgcacagggg | [GC]tgcgagctgaagttggtttg | 326 | 55 | RSDGGE-5F/R | DB: Leiden | DGGE | PCR-B | |
| 6 | cccgatgtgatggtgacagg | ctttgttctgactttctctggc | 62 | 245263-f/r | Sauer | SSCA | PCR-A | ||
| 6 | ccgatgtgatggtgacagg | tgtgtgagggggtcccta | 261 | 62 | 2.5 | 6f/r | DB: Berger | SSCA | |
| 6 | cccgatgtgatggtgacagg | aaatatagccctgtccatctc | 245263-f/TO4471 | DB: Franco, Sauer | SSCA | ||||
| 6 | [GC]tgtgatggtgacaggatttc | tctgtgccagtcaccccctg | 271 | 55 | RSDGGE-6F/R | DB: Leiden | DGGE | PCR-B |
Legend
Exon: number of exon amplified (numbering acc. to Sauer
et al.).
Forward primer: sequence of forward primer. Reverse primer:
sequence of reverse primer. Product size (bp): size of PCR-product
generated, given in base pairs. Ta (ºC): annealing temperature used in
PCR, in ºC. MgCl2 (mM): concentration of MgCl2 in PCR-reaction, given in
miliMolar. Name: name of primers Reference: literature
reference for primer sequence, DB = reported directly to the database by the person
listed. Technique: technique used for mutation detection, DGGE =
denaturing gradient gele-electrophoresis, SSCA = single-strand conformation analysis. PCR-conditions:
conditions for the PCR reaction.
[GC] = GC-clamp (5'-cgcccgccgcgccccgcgcccggcccgccgccgcggccgc-3').
PCR-A (from Sauer et al.)
PCR-B (from Kraayenbrink)
PCR mix: 1* supertaqbuffer, 12.5 pmol of each primer, 600 uM dNTP's, 1.5mM extra MgCl2, 1.5 U AmpliTaq, 200 ng DNA (patient), 100 ng DNA (control).
PCR program: denaturation 3 min. 94ºC; 35 cycli of 45 sec. 94ºC / 45 sec 55ºC / 1 min 72ºC; final extension 7 min. 72ºC; denaturation 5 min. 94ºC; renaturation 10 min. 55ºC
PCR-fragments / DGGE-electrophoresis (at 58ºC):
| Exon | 1 | 2 | 3 | 4a | 4b | 5 | 6 |
| product (bp) | 225 | 213 | 227 | 194 | 161 | 326 | 271 |
| calculated melting T (ºC) | 73 | 67 | 76 | 73 | 76 | 75 | 79 |
| melting % UF | 47 | 28 | 56 | 47 | 56 | 53 | 66 |
| Top of page | RetinoschisisDB homepage |