Transthyretin (TTR) - coding DNA reference sequence

(used for mutation description)

(last modified April 1, 2011)

This file was created to facilitate the description of sequence variants in the TTR gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009490.1, covering TTR transcript NM_000371.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5016
                                             gttgactaagtcaata       c.-121

 .         .         .         .         .         .                g.5076
 atcagaatcagcaggtttgcagtcagattggcagggataagcagcctagctcaggagaag       c.-61

 .         .         .         .         .         .                g.5136
 tgagtataaaagccccaggctgggagcagccatcacagaagtccactcattcttggcagg       c.-1

          .         .         .         .         .         .       g.5196
 ATGGCTTCTCATCGTCTGCTCCTCCTCTGCCTTGCTGGACTGGTATTTGTGTCTGAGGCT       c.60
 M  A  S  H  R  L  L  L  L  C  L  A  G  L  V  F  V  S  E  A         p.20

           | 02        .         .         .         .         .    g.6180
 GGCCCTACG | GGCACCGGTGAATCCAAGTGTCCTCTGATGGTCAAAGTTCTAGATGCTGTC    c.120
 G  P  T   | G  T  G  E  S  K  C  P  L  M  V  K  V  L  D  A  V      p.40

          .         .         .         .         .         .       g.6240
 CGAGGCAGTCCTGCCATCAATGTGGCCGTGCATGTGTTCAGAAAGGCTGCTGATGACACC       c.180
 R  G  S  P  A  I  N  V  A  V  H  V  F  R  K  A  A  D  D  T         p.60

          .         . | 03       .         .         .         .    g.8393
 TGGGAGCCATTTGCCTCTGG | GAAAACCAGTGAGTCTGGAGAGCTGCATGGGCTCACAACT    c.240
 W  E  P  F  A  S  G  |  K  T  S  E  S  G  E  L  H  G  L  T  T      p.80

          .         .         .         .         .         .       g.8453
 GAGGAGGAATTTGTAGAAGGGATATACAAAGTGGAAATAGACACCAAATCTTACTGGAAG       c.300
 E  E  E  F  V  E  G  I  Y  K  V  E  I  D  T  K  S  Y  W  K         p.100

          .         .         .       | 04 .         .         .    g.11825
 GCACTTGGCATCTCCCCATTCCATGAGCATGCAGAG | GTGGTATTCACAGCCAACGACTCC    c.360
 A  L  G  I  S  P  F  H  E  H  A  E   | V  V  F  T  A  N  D  S      p.120

          .         .         .         .         .         .       g.11885
 GGCCCCCGCCGCTACACCATTGCCGCCCTGCTGAGCCCCTACTCCTATTCCACCACGGCT       c.420
 G  P  R  R  Y  T  I  A  A  L  L  S  P  Y  S  Y  S  T  T  A         p.140

          .         .                                               g.11909
 GTCGTCACCAATCCCAAGGAATGA                                           c.444
 V  V  T  N  P  K  E  X                                             p.147

          .         .         .         .         .         .       g.11969
 gggacttctcctccagtggacctgaaggacgagggatgggatttcatgtaaccaagagta       c.*60

          .         .         .         .         .         .       g.12029
 ttccatttttactaaagcagtgttttcacctcatatgctatgttagaagtccaggcagag       c.*120

          .         .         .         .         .         .       g.12089
 acaataaaacattcctgtgaaaggcacttttcattccactttaacttgattttttaaatt       c.*180

          .         .         .         .         .         .       g.12149
 cccttattgtcccttccaaaaaaaagagaatcaaaattttacaaagaatcaaaggaattc       c.*240

          .         .         .         .         .         .       g.12209
 tagaaagtatctgggcagaacgctaggagagatccaaatttccattgtcttgcaagcaaa       c.*300

          .         .         .         .                           g.12258
 gcacgtattaaatatgatctgcagccattaaaaagacacattctgtaaa                  c.*349

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Transthyretin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.