receptor-associated protein of the synapse (RAPSN) - 734 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.11583
gtggggcagcggggaagggggcaggtcggggatgaggtggtgtgggccaggggctggggc  c.690+60

         .         .         .         .         .         .  g.11643
ctgggacagcagggcttccttcttccaaatcagcccatggaagccccctagggcttgcct  c.690+120

         .         .         .         .         .         .  g.11703
ctggcccagcctctctaaaggcgtgcaccaccatgcacagctaattttatttttgtagag  c.690+180

         .         .         .         .         .         .  g.11763
acggggtctcactaaaccaccctcctgtgctgaagcgatcctcgtgtcttggcctcccaa  c.690+240

         .         .         .         .         .         .  g.11823
agtgctgggattccaggcatgagccacttgtgcctggcccagtttttattttttaaatga  c.690+300

         .         .         .         .         .         .  g.11883
gatgagttctctacagctgaacccctgaaggaaacatttgtcccccagcctcatcccaaa  c.690+360

         g.11890
cccactc  c.690+367

--------------------- middle of intron ---------------------
                                          g.11891             g.11897
                                          c.691-367  ccttcca  c.691-361

.         .         .         .         .         .           g.11957
atccatctgcaggggagggggcttccttctgccccaacaccctatatggggtactttgaa  c.691-301

.         .         .         .         .         .           g.12017
gggtagagacggaagagggccagtttctggagtcccactgacctgggttcacatcccagc  c.691-241

.         .         .         .         .         .           g.12077
tttgtcacttactgggtgaccccaatcaagtcacttctctttgagcctcactttccaccc  c.691-181

.         .         .         .         .         .           g.12137
accttgctgggtgctgtgacttcagtggttcagtgtgtgagccctcagcaccatgataga  c.691-121

.         .         .         .         .         .           g.12197
ttcactaggctctgaggatgttgcttccctgggctgtcccttcagaggggtctgttgagg  c.691-61

.         .         .         .         .         .           g.12257
ggagggcactccagtggtggtggcagaggagtaggcctgagccactggcctccctcgcag  c.691-1


Powered by LOVD v.2.0 Build 29
©2004-2011 Leiden University Medical Center