Myozenin 3 (MYOZ3) - coding DNA reference sequence

(used for mutation description)

(last modified April 20, 2012)


This file was created to facilitate the description of sequence variants in the MYOZ3 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_032584.1, covering MYOZ3 transcript variant-1 (NM_001122853.2). MYOZ3 transcript variant-2 (NM_133371.4) uses an alternative splice site in exon 1, shortening the 5' UTR.

Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.5048
             gagaaaagaaggcaggcaggaaggaggcagaagaagaaaggcaggaga       c.-541

 .         .         .         .         .         .                g.5108
 gaagaaaggaaggaagaaaaggataagtcaagcaaagatattgaggagcaattcattcat       c.-481

 .         .         .         .         .         .                g.5168
 ccatctatctatccatccattccttccttcgacaaatatctgctgagttcctatcaagca       c.-421

 .         .         .         .         .         .                g.5228
 ccattcttggcactaaggatataacagttaacaagcggaagctaccagcagctgaccctc       c.-361

 .         . /          .         .         .         .                g.5288
 aacatttccag / gtgactttggtgtgtgcatatgtgagtgtgtgtgtacacgtgggtgcaa       c.-301
             /
             ^  alternative splice site exon 1

 .         .         .         .         .         .                g.5348
 gccctctgtctgcacaggcctgttgccagggcacctgtcttccctagggtctggtgcttt       c.-241

 .         .         .         .         .         .                g.5408
 tagcctctggctccagctcctattgcagcccgaaataaggctgtgacccatggcaaggca       c.-181

 .         .         .         .         .         .                g.5468
 ggaatgattctcatcagctgaagccagagctggctgcaggggacaccctgctcgctgcct       c.-121

 .         .         .         .         .         .                g.5528
 actgactgctgaccgctgactgcctacagggacgccacgcaactctcagcttcccgacag       c.-61

 .         .         .         .         .         .         | 02    g.7101
 aggtgttaatcttgagggtctaagattccctcctgcctattgtggtcccatcctctcag | g    c.-1

          .         .         .         .         .         .       g.7161
 ATGATCCCCAAGGAGCAGAAGGGGCCAGTGATGGCTGCCATGGGGGACCTCACTGAACCA       c.60
 M  I  P  K  E  Q  K  G  P  V  M  A  A  M  G  D  L  T  E  P         p.20

   | 03      .         .         .         .         .         .    g.14702
 G | TCCCTACGCTGGACCTGGGCAAGAAGCTGAGCGTGCCCCAGGACCTGATGATGGAGGAG    c.120
 V |   P  T  L  D  L  G  K  K  L  S  V  P  Q  D  L  M  M  E  E      p.40

          .         .         .         .         .         .       g.14762
 CTGTCACTACGCAACAACAGAGGGTCCCTCCTCTTCCAGAAGAGGCAGCGCCGTGTGCAG       c.180
 L  S  L  R  N  N  R  G  S  L  L  F  Q  K  R  Q  R  R  V  Q         p.60

          .         .         .       | 04 .         .         .    g.15780
 AAGTTCACTTTCGAGTTAGCAGCCAGCCAGCGGGCG | ATGCTGGCCGGAAGCGCCAGGAGG    c.240
 K  F  T  F  E  L  A  A  S  Q  R  A   | M  L  A  G  S  A  R  R      p.80

          .         .         . | 05       .         .         .    g.15944
 AAGGTGACTGGAACAGCGGAGTCGGGGACG | GTTGCCAATGCCAATGGCCCTGAGGGGCCG    c.300
 K  V  T  G  T  A  E  S  G  T   | V  A  N  A  N  G  P  E  G  P      p.100

          .         .         .         .         .         .       g.16004
 AACTACCGCTCGGAGCTCCACATCTTCCCGGCCTCACCCGGGGCCTCACTCGGGGGTCCC       c.360
 N  Y  R  S  E  L  H  I  F  P  A  S  P  G  A  S  L  G  G  P         p.120

          .         .         .         .         .         .       g.16064
 GAGGGCGCCCACCCTGCAGCCGCCCCTGCTGGGTGCGTCCCCAGCCCCAGCGCCCTGGCG       c.420
 E  G  A  H  P  A  A  A  P  A  G  C  V  P  S  P  S  A  L  A         p.140

      | 06   .         .         .         .         .         .    g.16555
 CCAG | GCTATGCGGAGCCGCTGAAGGGCGTCCCGCCAGAGAAGTTCAACCACACCGCCATC    c.480
 P  G |   Y  A  E  P  L  K  G  V  P  P  E  K  F  N  H  T  A  I      p.160

          .         .         .         .         .         .       g.16615
 TCCAAGGGCTACCGCTGCCCTTGGCAGGAGTTCGTCAGCTACCGGGACTACCAGAGCGAT       c.540
 S  K  G  Y  R  C  P  W  Q  E  F  V  S  Y  R  D  Y  Q  S  D         p.180

          .         .         .         .        | 07.         .    g.20879
 GGCCGAAGTCACACCCCCAGCCCCAACGACTACCGAAATTTCAACAA | GACCCCGGTGCCA    c.600
 G  R  S  H  T  P  S  P  N  D  Y  R  N  F  N  K  |  T  P  V  P      p.200

          .         .         .         .         .         .       g.20939
 TTTGGAGGACCCCTCGTGGGGGGCACTTTTCCCAGGCCAGGCACCCCCTTCATCCCGGAG       c.660
 F  G  G  P  L  V  G  G  T  F  P  R  P  G  T  P  F  I  P  E         p.220

          .         .         .         .         .         .       g.20999
 CCCCTCAGTGGCTTGGAACTCCTCCGTCTCAGACCCAGCTTCAACAGAGTGGCCCAGGGC       c.720
 P  L  S  G  L  E  L  L  R  L  R  P  S  F  N  R  V  A  Q  G         p.240

          .         .         .                                     g.21035
 TGGGTCCGTAACCTCCCAGAGTCCGAGGAGCTGTAG                               c.756
 W  V  R  N  L  P  E  S  E  E  L  X                                 p.251

          .         .         .         .         .         .       g.21095
 ccctagcctgaatcttcagttccccagtctcgggggcctggtaacatccggagccaagac       c.*60

          .         .         .         .         .         .       g.21155
 ttgtggacagcacttcacagttgaagaagggccttcacacacaaaacctgattgcaaatg       c.*120

          .         .         .         .         .         .       g.21215
 gcttcagaggtcaccaagttcagtcgtcccaaaacatgggtgtgtttcaaaattacctgg       c.*180

          .         .         .         .         .         .       g.21275
 ggatgttgttccaaatccagacaactggactgtcccagacttgcagcatcagagtctcct       c.*240

          .         .         .         .         .         .       g.21335
 gagtcgaggaatctgtattattaatagcaaccagggccgggtgtcgtggctcacgcctgt       c.*300

          .         .         .         .         .         .       g.21395
 catcccagcactttgggaggccgaggcaggaggatcacctgaggtcaggagtttgagacc       c.*360

          .         .         .         .         .         .       g.21455
 agtctggccaaaatagtggaaccccgtcgctactaaaaatacaaaaatgagtcggacatg       c.*420

          .         .         .         .         .         .       g.21515
 gtggtgcatgcctgtaatcccagctacttgggaggctgagacaggagaatcacttgaact       c.*480

          .         .         .         .         .         .       g.21575
 aggaggcagaggttgcagtgagccgagattgcgccactgcaccccagcctggacaacaga       c.*540

          .         .         .         .         .         .       g.21635
 gtgagactccttctcaaaagtaaataaataaatagcaaccagtactccaggtgattccag       c.*600

          .         .         .         .         .         .       g.21695
 cataacttatccatggtttgtgtcattaggagtccacatccacacctctgctctttcctg       c.*660

          .         .         .         .         .         .       g.21755
 ttcctgtagtgtacactcccccggtgacagggtgctcactggcaccccatcttcctgtga       c.*720

          .         .         .         .         .         .       g.21815
 ataactcaaataattagaaaatgttccttttactgagatgcagttggtcttcatctattc       c.*780

          .         .         .         .         .         .       g.21875
 atgctctaaacagttcctaagcgctgactgtgcgctagacactgccaggcccgggcctcg       c.*840

          .         .         .         .         .         .       g.21935
 aggaggaaaagacagtagggaagacattatagagcatgaagtcaccataattttccctaa       c.*900

          .         .         .         .         .         .       g.21995
 agcatgcttattgacaattgaggaacaaagtgttgtggagcagaagaaggagtccctcac       c.*960

          .         .         .         .         .         .       g.22055
 cctaggtgtgagatgggattctggaagcttcctgaaggatttgagtgggaccttgtggga       c.*1020

          .         .         .         .         .         .       g.22115
 ggcgtgagagtccatgaagggggtgtgagggggagggtatttctggaaagtggaccagca       c.*1080

          .         .         .         .         .         .       g.22175
 tgtgcaaaaatatggaactgagcacgggtgcagggtgttctgcagaagggagaaggctgt       c.*1140

          .         .         .         .         .         .       g.22235
 gctagaggagccagtgagggccagcatggggtgggcttcactaaggaaatggggaaggtt       c.*1200

          .         .         .         .         .         .       g.22295
 ttagtgatgggtcttgctgggtgctgtgtggggcgcatattggagaagggtaatgccaga       c.*1260

          .         .         .         .         .         .       g.22355
 agccaggaagcctgcaagggatgaggccatgggaatggagagaaggggccacccactggg       c.*1320

          .         .         .         .         .         .       g.22415
 cacctaacaggacaggtgcaaagtggggtgcttattaagattccttctttccactccatt       c.*1380

          .         .         .         .         .         .       g.22475
 ttgagcaggctgcttaaagtggtggtgatgatgatgatgatgatggcagctttatatcga       c.*1440

          .         .         .         .         .         .       g.22535
 gtgcctcagtgcttgggctggtagtagtttctctacatatcttatttctaattctcagaa       c.*1500

          .         .         .         .         .         .       g.22595
 caaccctgagagaaagatattgttgtccccactttacagatgtggatatttaggccaaaa       c.*1560

          .         .         .         .         .         .       g.22655
 ggaggaagtgacttgtccaggggcagacaccaaatgggaatctgattccagtggatgtct       c.*1620

          .         .         .         .         .         .       g.22715
 cttttcagtgcactgggtggtcaatgcccactcgctctgaaatcatctgactgtgatgcc       c.*1680

          .         .         .         .         .         .       g.22775
 ctgccttggagtttagaagttgagtgcaggcttgggagtcagactggatggggtaggttc       c.*1740

          .         .         .         .         .         .       g.22835
 taactctgccactgctagccggatgaacttgagcaagtcatttcacatctccgagcctct       c.*1800

          .         .         .         .         .         .       g.22895
 gtttctccaagtgtaagatgaggacaagtataaaacctcctttatgggtttgttgtgaac       c.*1860

          .         .         .         .         .         .       g.22955
 acagtgcagggcacatttataataagagctcagtcaatggtaggtttcatgcaactgctg       c.*1920

          .         .         .         .         .         .       g.23015
 ctctaggctggaaaagttgttcttgcactggatgcagcatgagaagctggctgctaagat       c.*1980

          .         .         .         .         .         .       g.23075
 gtcactgggggtcactaaagctgaagcctgaaggaaagcctctcattgctgtagagctct       c.*2040

          .         .         .         .         .         .       g.23135
 ccctgcctctctctctgggggcgatggggaaggtcaggagtccagcccattcccagggtg       c.*2100

          .         .         .         .         .         .       g.23195
 tgtgggatagcgattgcattttccttttgctctggagtttcactccccttctgggtccca       c.*2160

          .         .         .         .         .         .       g.23255
 agggcccaatggcctgacttttagaattgcttgcaattggtgttttctcttgaatttggg       c.*2220

          .         .         .         .         .         .       g.23315
 ggctgccatttaaagccaggtttccatgagctgaagaccagccattcaagaatctgaaaa       c.*2280

          .         .         .         .         .         .       g.23375
 gtagacaagaggactccagttgcctcaggttggttctgctgtgctctggaaagtaactgc       c.*2340

          .         .         .         .         .         .       g.23435
 agccaccaggtatgaaaaggagcctggtggggagaccactgcacccaaaacaaatccttt       c.*2400

          .         .         .         .         .         .       g.23495
 cttcttctgagaatgtgactttttctggtgttgtaaaaaagaaaaaaaaaagaatgctca       c.*2460

          .         .         .                                     g.23528
 ttgtaaaaataaaaaaataataataagcaagga                                  c.*2493

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Myozenin 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 34
©2004-2012 Leiden University Medical Center