Collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ) - 440 nt intron 14 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.70352
gtacccccaggccattacctcaggacatactccctgcccaggagagagatgcatccatta  c.1074+60

         .         .         .         .         .         .  g.70412
aaggaagggaaggccaccccactgggcctggggagggctttctacagtctgtctgcatgg  c.1074+120

         .         .         .         .         .         .  g.70472
gagggctgagcatcctccctcaaactctctctgagcagccctccattcccccaccctgac  c.1074+180

         .         .         .         .  g.70512
tcccaaatagaagcccctctctgagccagggttccagatg  c.1074+220

--------------------- middle of intron ---------------------
        g.70513     .         .         .         .           g.70552
        c.1075-220  gtctccacatccctgcgtgccaggttgctgtcttgatctg  c.1075-181

.         .         .         .         .         .           g.70612
acccaacatttaaccagctacagagctctgggcaacaggaaaggagtacctttcccaccc  c.1075-121

.         .         .         .         .         .           g.70672
ctgggaggaagtcaaggcatgccccccagcagtgcctttggaccaaaaccaatgacctcc  c.1075-61

.         .         .         .         .         .           g.70732
ctgcctgcggctgcctgggtatgccatgctccagttaatgctgtgtgcttctttggccag  c.1075-1


Powered by LOVD v.2.0 Build 29
©2004-2011 Leiden University Medical Center