Collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase (COLQ) - 334 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.47474
gtatggaccactactttcttcaacccttctttccttggcaattccagcctgttttctggg  c.366+60

         .         .         .         .         .         .  g.47534
catcccactgagaatttcctagttgagatttccaaacatgtgctaactctgccttggtga  c.366+120

         .         .         .         .         g.47581
gaggctgggttccatgatggctgggctgctgcagcacatatgggata  c.366+167

--------------------- middle of intron ---------------------
  g.47582           .         .         .         .           g.47628
  c.367-167  ccactggtgtattttgacgtggcctatcgacatggcagaggggccgt  c.367-121

.         .         .         .         .         .           g.47688
gagcagcagccaagcaactgagccacatggccatgcccagtcatcagctctactaaggct  c.367-61

.         .         .         .         .         .           g.47748
tctgcttccagaacatctcttccaaagcagcctctccttacctgtcttctccatccatag  c.367-1


Powered by LOVD v.2.0 Build 29
©2004-2011 Leiden University Medical Center