Cofilin-2 (CFL2) - coding DNA reference sequence

(used for mutation description)

(last modified January 25, 2010)


This file was created to facilitate the description of sequence variants in the CFL2 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_012740.1, covering transcript variant 2 (NM_138638.4). Intron 1 contains an alternative promoter /exon 01b, used in transcript variant 1 (NM_021914.7). Exon 02 sometimes uses an alternatively splice donor site, encoding a truncated protein.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                     .         .         .         .                g.5043
                  cgcgctctgaggtcaggccgaggacgcggacagccggggagcc       c.-241

 .         .         .         .         .         .                g.5103
 ggggccgcgagacagaagggccggcctgggagcgggtggcgccggctggggaccaggcgt       c.-181

 .         .         .         .         .         .                g.5163
 gcccacgtgaccgccccgcccgctgcctgcggcccgccgagccccgccacctccctcggg       c.-121

 .         .         .         .         .         .                g.5223
 ctgcagctcccggcgtgccccgcactctccgctgcccacccgctcgcccgcccctccttc       c.-61

 .         .         .         .         .         .                g.5283
 tcctcccagtgccacagagccgaagcccgagctgccgccgcagccacagccgagggcact       c.-1

     | 02    .         .         .         .         .         .    g.6319
 ATG | GCTTCTGGAGTTACAGTGAATGATGAAGTCATCAAAGTTTTTAATGATATGAAA | GTA    c.60
 M   | A  S  G  V  T  V  N  D  E  V  I  K  V  F  N  D  M  K   | V      p.20
   alternative exon 02 splice donor site in some transcripts  ^

          .         .         .         .         .         .       g.6379
 AGGAAATCTTCTACACAAGAGGAGATCAAAAAGAGAAAGAAAGCAGTTCTCTTCTGTTTA       c.120
 R  K  S  S  T  Q  E  E  I  K  K  R  K  K  A  V  L  F  C  L         p.40

          .         .         .         .         .         .       g.6439
 AGCGATGACAAAAGACAAATAATTGTAGAGGAAGCAAAGCAGATCTTGGTGGGTGACATT       c.180
 S  D  D  K  R  Q  I  I  V  E  E  A  K  Q  I  L  V  G  D  I         p.60

          .         .         .         .         .         .       g.6499
 GGTGATACTGTAGAGGACCCCTACACATCTTTTGTGAAGTTGCTACCTCTGAATGATTGC       c.240
 G  D  T  V  E  D  P  Y  T  S  F  V  K  L  L  P  L  N  D  C         p.80

          .         .         .         .         .         .       g.6559
 CGATATGCTTTGTACGATGCCACATACGAAACAAAAGAGTCTAAGAAAGAAGACCTAGTA       c.300
 R  Y  A  L  Y  D  A  T  Y  E  T  K  E  S  K  K  E  D  L  V         p.100

          .  | 03      .         .         .         .         .    g.6736
 TTTATATTCTG | GGCTCCTGAAAGTGCACCTTTAAAAAGCAAGATGATTTATGCTAGCTCT    c.360
 F  I  F  W  |  A  P  E  S  A  P  L  K  S  K  M  I  Y  A  S  S      p.120

          .         .         | 04         .         .         .    g.6878
 AAAGATGCCATTAAAAAGAAATTTACAG | GTATTAAACATGAGTGGCAAGTAAATGGCTTG    c.420
 K  D  A  I  K  K  K  F  T  G |   I  K  H  E  W  Q  V  N  G  L      p.140

          .         .         .         .         .         .       g.6938
 GATGATATTAAGGACCGTTCGACACTTGGAGAGAAATTGGGAGGCAATGTAGTAGTTTCA       c.480
 D  D  I  K  D  R  S  T  L  G  E  K  L  G  G  N  V  V  V  S         p.160

          .         .                                               g.6959
 CTTGAAGGAAAACCATTATAA                                              c.501
 L  E  G  K  P  L  X                                                p.166

          .         .         .         .         .         .       g.7019
 aatgacagtcaagtgccatctggatcttaaggagcttccatttctccagctcagtccatt       c.*60

          .         .         .         .         .         .       g.7079
 ggaatagtattaggttttggttttttgttgtatttccccctttccactgggcccttccaa       c.*120

          .         .         .         .         .         .       g.7139
 cacaatgaatgaaggaaatatcatttatttaagcagcctatcagtgattgccattagact       c.*180

          .         .         .         .         .         .       g.7199
 gttgaatactgttacttttatatagaacccaaggaatgccttcctgtcatattttagcca       c.*240

          .         .         .         .         .         .       g.7259
 aaacaactggttatatgcctcccttgcagcaagcactacaatgtatgtgatcgtcaatgt       c.*300

          .         .         .         .         .         .       g.7319
 gaatagcttagaatactgcaaaggataagctaattgaatgccttgaaagtattatccact       c.*360

          .         .         .         .         .         .       g.7379
 ggtcagatggtcaacttttttcagtattatttatagttggcacttgattgcagttctgtg       c.*420

          .         .         .         .         .         .       g.7439
 aggcttgagcattcatacacctcacctgccttggcaagcctattttagtgatatggcagc       c.*480

          .         .         .         .         .         .       g.7499
 acggatataacactatgcattaaaagcactttttgtaataagtttaatatcctaaaagga       c.*540

          .         .         .         .         .         .       g.7559
 atgccaattaagttttgttaactgtgtcatcaacttatcctagtacctcagtgttcattc       c.*600

          .         .         .         .         .         .       g.7619
 ctgttacctgcatatcttcttaaaagaaatagctgttattaatgcctttttgttttccat       c.*660

          .         .         .         .         .         .       g.7679
 tgagtgtacactactgaataagtgtaggagttttatgtttaccatgtgagtcctgcaaca       c.*720

          .         .         .         .         .         .       g.7739
 ctaaagatattttgaatatcagtcatgatggcaatttctgtataaaagagccttaaatgg       c.*780

          .         .         .         .         .         .       g.7799
 aacattgttttgagatcaaactccccaccctcacaaaaatggccacgttgcaataaaaat       c.*840

          .         .         .         .         .         .       g.7859
 tgtggcatattacagaacgttgccttgttttccttggaaattttgcaaaatgttatgtga       c.*900
       ^ ^  ^ ^ polyA addition sites

          .         .         .         .         .         .       g.7919
 aacaacttctagggtaaaaacagctattactaatctctgcactggtcatttgagaatttt       c.*960

          .         .         .         .         .         .       g.7979
 ttttgtacagcattcatgtgtgatattttccagatttgttggatctatttggtttaaaaa       c.*1020

          .         .         .         .         .         .       g.8039
 gtattctatcttaaggccaactaatataaaataccattgttaaagaatggtacttttata       c.*1080

          .         .         .         .         .         .       g.8099
 aacattagtgtatttatttcctatgtgttaatatgaagatcagaaattattttttgcact       c.*1140

          .         .         .         .         .         .       g.8159
 ttggcataaatacttttcaatatctgatttgttctctggataaattagcatagttatttt       c.*1200

          .         .         .         .         .         .       g.8219
 tttattcacatttacatttctaagtagttgtatagtagaagcaggaagctcttattgctt       c.*1260

          .         .         .         .         .         .       g.8279
 atttggtcgtaatgaaaataatttgtaaaatgtcctttaaaagtttaatgatacttctga       c.*1320

          .         .         .         .         .         .       g.8339
 tgtttcggaacagtcatttcacctactatttctgaatatattttgcaaattgaattggaa       c.*1380

          .         .         .         .         .         .       g.8399
 taggaattgataatagcagtcttaaacattagtagtgggatttggctatggtccagactg       c.*1440

          .         .         .         .         .         .       g.8459
 tgctccttatagagaatttgatctgctcagtgtgagcggtttgctgttagccagggctat       c.*1500

          .         .         .         .         .         .       g.8519
 ttatggcaaacacatgcttttgtatcttgtcatagttatccacaaatggcaaaactggac       c.*1560

          .         .         .         .         .         .       g.8579
 ttgattctactggtatgcaaaacaggcatgctagtaagcagtcagtcgtggctcagaact       c.*1620

          .         .         .         .         .         .       g.8639
 taaccccatagctcagaggaatgcttttagcagaaaacaggaaagaaaatatcccttaaa       c.*1680

          .         .         .         .         .         .       g.8699
 aattttttttgaatgtgtggaagtaattttagtataattagattttttccatatttttga       c.*1740

          .         .         .         .         .         .       g.8759
 aagatttttcagatgtgaacattaaaaatagggattaaatgtctaggcttccatttaaaa       c.*1800

          .         .         .         .         .         .       g.8819
 ttatatgaatggtttgggatctttttgcactgagcaattttatttcaggcttccagctgt       c.*1860

          .         .         .         .         .         .       g.8879
 ccctgtgagttatcctggacatttcgatggtttttggtaaggccaaactctgataagcaa       c.*1920

          .         .         .         .         .         .       g.8939
 aacagagaatactgacgtatacttaaccatatgtgtaactgatacttggcaccatggaat       c.*1980

          .         .         .         .         .         .       g.8999
 ttttcattgagttatttcctcattcttttaaaaaataagggactataaatcagttatgta       c.*2040

          .         .         .         .         .         .       g.9059
 gtatcttttgtttttgtagctgattccttaactttcttgtatgcctctagtaatttcaga       c.*2100

          .         .         .         .         .         .       g.9119
 gattaaatattgctttaaactgtgatactttgatttgctagattgacaaaactgatacta       c.*2160

          .         .         .         .         .         .       g.9179
 atataattaagttcatctttgaaatacatctttgtgcgtagagccaaaaaaagagataaa       c.*2220

          .         .         .         .         .         .       g.9239
 attaataatagttcacttgttatttgagattaatttggcatttgaaatgatcattttatt       c.*2280

          .         .         .         .         .         .       g.9299
 ttacaatcatttataatgaatcaatgttccagttagctttaaaaggtatacggtgctaat       c.*2340

          .         .         .         .         .         .       g.9359
 tagtaaaatattgaaggcaatattttactgctagcttgcaaagttatgagagtttaaaaa       c.*2400

          .         .         .         .         .         .       g.9419
 ataaaatatatgaaaatatgtaaagctgttgagatgtgtttacttatacttcagaacatt       c.*2460
      ^ ^ ^    ^ polyA addition sites

          .         .                                               g.9442
 aaaagtttaaaaactggtatttc                                            c.*2483
             ^     ^    ^ polyA addition sites

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Cofilin-2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.


Powered by LOVDv.2.0-22 Build 22
©2004-2009 Leiden University Medical Center