(last modified December 29, 2004)
| Exon | Position | Length (in bp) | Forward / reverse primer | Name | Reference |
|---|---|---|---|---|---|
| 1 - 6 | -226 - 841 | 2006 | CTCCCGCGGTTAGGTCCCGCCC / CACCCCCACTGCTAAGGCAGTCAGC | PLf / PMr | Bione (1995) |
| 1 | -176 | GCGGCCGTGACGCGACAACG | PFf | Bione (1995) | |
| 1 | -20 | CGCCTGAGCCCGCACCCGC | PCf | Bione (1995) | |
| 2 | 103 | CGTAAAGCCTACGAGTTGATCg | P6r | Bione (1995) | |
| intron 2 | 187+37 | gggaggatggggtcgcgagg | P13f | Bione (1995) | |
| intron 2 | 188-54 | ttctccagtgccgctctcgac | P12r | Bione (1995) | |
| intron 3 | 266-77 | tgggattcagattagggccatcag | P14f | Bione (1995) | |
| intron 3 | 266-93 | cagtttctccctcctaaggctgc | PGr | Bione (1995) | |
| intron 4 | 399+96 | ccaccatttgtacccagtgcc | P15r | Bione (1995) | |
| intron 4 | 400-187 | gcatgagcacaagtggcaaggc | P16f | Bione (1995) | |
| intron 5 | 449+19 | cagggacgggctggttctggg | P17f | Bione (1995) | |
| 6 | 500 | TAGTGCGTGATGCTCTGGTAGG | P18r | Bione (1995) | |
| 6 | 642 | GGCTGGGCCAGGATCGCCAG | P8f | Bione (1995) | |
| 6 | 728 | TAAATGAAGAAGAGGACGATCAC | P4r | Bione (1995) |
Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and
added primer tails in italics. Location: location of primer (numbering of exons is
according to Bione
et al. [1995]).Position: position of primer (numbering
according to the coding DNA Reference Sequence). Length (in bp): length of
PCR-product in basepairs. Forward / reverse primer: sequence of forward
and reverse primer.
Name: name of the primers. Reference: publication describing the
primer(s).
| Exon | Position | Length (in bp) | Forward / reverse primer | Name | Reference |
|---|---|---|---|---|---|
| 1 - 6 | -226 - 841 | 2006 | CTCCCGCGGTTAGGTCCCGCCC / CACCCCCACTGCTAAGGCAGTCAGC | PLf / PMr | Bione (1995) |
Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and
added primer tails in italics. Location: location of primer (numbering of exons is
according to Bione
et al. [1995]).Position: position of primer (numbering
according to the coding DNA Reference Sequence). Length (in bp): length of
PCR-product in basepairs. Forward / reverse primer: sequence of forward
and reverse primer.
Name: name of the primers. Reference: publication describing the
primer(s).
| Top of page | LMDp homepage
|
| NMD diagnosis |
| Remarks / information | Copyright©,
liability |