(last modified December 17, 2004)
| Amplified | Length | Primer | Name | Reference | |
|---|---|---|---|---|---|
| forward | reverse | ||||
| exon 1 (-38 - i1) |
176 | AGCTCGGATCTCCTCCTGTGG | ccgaggcaggcctgcagagcc | HC3-7F/E1-3 | McNally |
| exon 2 (i1 - 257) |
194 | gagttgaggcttccccttgcc | CGAACAGGAAGCCCCAGAGCA | HC3-E2-5/-2 | McNally |
| exon 2 (169 - 441) |
273 | GTGTGGAAGGTGAGCTACAC | CAGCACCACCTTGATGCTGCTGCA | CAV17/CMB | Minetti |
| exon 2 (208 - 441) |
234 | TACTGGTGCTACCGTCTGTTG | CAGCACCACCTTGATGCTGCTGCA | CAV8/CMB | Minetti |
| exon 2 (216 - 482) |
267 | CTACCGTCTGTTGTCCACGCT | tgccaccgctgttgccccacc | HC3-1/-3UTR | McNally |
| exon 2 (538 - 1330) |
793 | tggcgagctctttctctttag | ATTTCCATAGTGAGTCCACACACG | CAV10/7 | Minetti |
Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and
added primer tails in italics. Amplified: region amplified. Numbering of exons is
according to McNally,
see Reference sequence. Length: length of
PCR-product in basepairs. Primer /forward: sequence of forward primer / reverse:
sequence of reverse primer. lower case lettering indicatis intronic location, bold/italic
indicates location in alternatively spliced "intron 2" (see above). Name:
name of the primers. Reference: publication describing the primer(s).
| Amplified | Length | Primer | Name | Reference | |
|---|---|---|---|---|---|
| forward | reverse | ||||
| -38 - 192 | 230 | AGCTCGGATCTCCTCCTGTGG | GGTGGTGTAGCTCACCTTCCA | HC3-7F/8R | McNally |
| 4 - 441 | 438 | ATGGCAGAAGAGCACACAGATCTC | CAGCACCACCTTGATGCTGCTGCA | Minetti | |
| .. - 399 | GAAGAGTGGGTTGCAGAAG | Minetti | |||
| 78 - 277 | 200 | CCGAGACCCCAAGAACATTAAC | CGAACAGGAAGCCCCAGAGCA | HC3-3/2 | McNally |
| 216 - 482 | 267 | CTACCGTCTGTTGTCCACGCT | tgccaccgctgttgccccacc | HC3-1/3UTR | McNally |
| 538 - 1330 | 793 | tggcgagctctttctctttag | ATTTCCATAGTGAGTCCACACACG | Minetti | |
Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and
added primer tails in italics. Amplified: region amplified. Numbering of exons is
according to McNally,
see Reference sequence. Length: length of
PCR-product in basepairs. Primer /forward: sequence of forward primer / reverse:
sequence of reverse primer. lower case lettering indicatis intronic location, bold/italic
indicates location in alternatively spliced "intron 2" (see above).
Name: name of the primers. Reference: publication describing the
primer(s).
| Top of page | LMDp homepage | Muscular dystrophies |
| Remarks / information | Copyright©,
liability |