Leiden Muscular Dystrophy pages©

Myotilin (TTID)

( LGMD-1A )

(last modified January 30, 2004)

Contents

Summary

The myotilin gene was first described as a gene showing a similarity to the Ig-like domains of titin. The myotilin gene, officially named TiTin Immunoglobulin Domain protein gene (Gene Symbol TTID, aliases myotilin and titin-like protein), contains 10 exons spread over 20 kb. TTID maps to chromosome 5q31 between markers AFM350yB1 and D5S500. The TTID gene is expressed in multiple muscle tissue types, including skeletal and cardiac muscle, as well as in thyroid gland and bone marrow. Myotilin is a 57 kDa cytoskeletal protein containing a unique N-terminal sequence and a C-terminal half which contains two Ig-like domains similar to titin. Myotilin co-localizes with alpha-actinin in the sarcomeric I-bands (Z-line) and directly interacts with alpha-actinin. Myotilin mapped to the candidate gene region for LGMD-1A and a new type of distal myopathy with vocal cord and pharyngeal weakness (VCPMD). Hauser showed that myotilin is mutated in a large North American LGMD-1A family of German descent. The change, 450C>T (Thr57Ile), was found in all patients and not in 396 control chromosomes. Recently, the same group identified a second myotilin mutation (164C>T / Ser55Phe) in an Argentinian family (Hauser et al., 2002).

The myotilin gene

Links to other databases:
Gene Symbol nomenclature   LocusLink    OMIM Gene Map   GDB

The myotilin gene was first described by Godley, as a gene showing a similarity to the Ig-like domains of titin. The myotilin gene, officially named TiTin Immunoglobulin Domain protein gene (Gene Symbol TTID, aliases myotilin [MYOT] and titin-like protein), contains 10 exons spread over 20 kb. TTID maps to chromosome 5q31 between markers AFM350yB1 and D5S500 (Godley, Salmikangas).

Exon Exon size (bp) Intron size
(in bp)		 5' cDNA position Splice after Remarks
1 (83) 2,490 (-294) - 5'UTR
2 567 4,822 -211 2 356 bp coding / 5'UTR
3 175 1,517 357 0  
4 102 3,196 532 0  
5 50 1,108 634 2  
6 133 1,279 684 0  
7 208 2,456 817 1  
8 166 651 1025 2  
9 134 216 1191 1  
10 641 - 1325 - 170 bp coding / 3'UTR

Legend:
Exon: numbering of exons and intron/exon boundaries are according to genomic sequence AC004820, compared to the cDNA with the first base of the Met-codon counted as position 1 (see cDNA Reference Sequence). Exon size: size of exon indicated in basepairs. Intron size: size of intron indicated in kilobasepairs. 5' cDNA position: first base of the exon (according to cDNA sequence reported by Godley). Splice after: splicing occurs in between of two coding triplets (0), after the first (1) or the second (2) base of a triplet. Remarks: 5'UTR = 5' untranslated region, 3'UTR = 3' untranslated region.

primers for DNA-amplification

The myotilin mRNA

Links to other databases:     UniGene: Hs.84665    RefSeq: NM_006790

The TTID gene is expressed in multiple muscle tissue types, including skeletal and cardiac muscle, as well as in thyroid gland and bone marrow.

primers for RNA-amplification

The myotilin protein

Links to other databases:   RefSeq: NP_006781

Myotilin is a 57 kDa cytoskeletal protein of 498 amino acids (calculated molecular weight 55.395kDa). The N-terminal sequence of myotilin is unique and not homologous to any other protein. It includes a 23-residue hydrophobic domain and a region rich in serine (27/96 residues). Although the function of this domain is unknown, it is possible that the hydrophobic stretch mediates the localization of small amounts of myotilin protein to the sarcolemmal membrane. The C-terminal half contains an internally repeated domain which resembles the N-terminal half of an Ig-like domain from the immense skeletal muscle protein titin (amino acids 263-330 and 361-430). 

Myotilin is localized to the Z-line and binds to alpha-actinin and (Salmikangas et al., 1999) and gamma-filamin (FLNC, van der Ven et al., 2000). Yeast two-hybrid experiments mapped the minimum alpha-actinin binding domain from amino acids 79-150 (Hauser et al. (2000) and the gamma-filamin binding site to within the C-terminal Ig domains of myotilin (aa 215-493, van der Ven et al., 2000). gamma-filamin colocalizes with alpha-actinin in the Z-disk in striated muscle and has been implicated in Z-disk assembly and myofibrillogenesis (van der Ven et al., 2000). 

myotilin antibodies

myotilin and disease: LGMD-1A

Links to other databases:   OMIM: 15900

LGMD-1A is a dominant disease with adult onset which was mapped to 5q31 (Ref....). Symptoms include a progressive weakness of the hip and shoulder girdles, as well as a distinctive dysarthric pattern of speech. Muscle of affected individuals shows degeneration of myofibers, variations in fiber size, fiber splitting, centrally located myonuclei and a large number of autophagic vesicles. Affected muscle also exhibits disorganization and streaming of the Z-line similar to that seen in nemaline myopathy.

Initially, Salmikangas showed that myotilin mapped to 5q31, in a narrow segment containing the candidate gene region for a dominantly inherited limb-girdle muscular dystrophy (LGMD-1A) and a new type of distal myopathy with vocal cord and pharyngeal weakness (VCPMD). Shortly later, Hauser et al. (2000) showed that myotilin is mutated in a large North American LGMD-1A family of German descent. The gene contained a 450C>T change predicted to cause a conversion of residue Threonine-57 to Isoleucine. The gene was found in all patients and not in 396 control chromosomes. Since the mutant allele was transcribed normally, LGMD-1A muscle contained normal levels of correctly localized myotilin and the missense change did not disrupt binding to alpha-actinin, the disease-causing effect of the mutation remained uncertain. Later, upon screening of an additional 86 families with a variety of neuromuscular pathologies, Hauser et al. (2002) identified a second change in the myotilin gene (164C>T / Ser55Phe) in an Argentinian family. Both of the observed myotilin mutations would have the effect of elongating the hydrophobic N-terminal sequence, possibly disturbing its interactions with the sarcolemmal membrane or with a n unknown binding partner Hauser et al. (2002).

Hauser et al. (2002) note striking similarities between LGMD1A and the nemaline myopathies, suggesting possible mechanisms by which myotilin mutations may give rise to disease. Myotilin and alpha-tropomyosin (NEM1) both bind to alpha-actinin. Missense mutations in alpha-tropomyosin give rise to nemaline myopathy (Laing et al. 1995), with Z-line streaming similar to that seen in LGMD1A. A primary roles of alpha-actinin is to tether actin filaments to the Z-line, and missense mutations in alpha-actin also give rise to nemaline myopathy (Nowak et al. 1999).

myotilin sequence variations (mutations and polymorphisms)

Miscellaneous

DNA-primers

Amplified Length Forward primer /
reverse primer		 Name Reference
exon 2a 546 cagatctgaaagatgtcaaataaacaa /  GTTGTAACCCTTTGGCCTGG   Hauser
2b 481 CTCAACAAGGAAGAGCAGAC / TACTGCTATTGTAATCAGGC   Hauser
2c 476  GCTCCAGATTGCAGCCTCCT / ccagtaccctggttcagcat   Hauser
exon 3 373 atttgcaaaatgaggccaag /
gggcccaaatattccttctt		   Hauser
exon 4 273 tgtctcaataaattctctaaagcg / gtggatggaactgaccgact   Hauser
exon 5 462  ctgggcttcttgctagagtggtag / 
gatcctggcttatttgacc		   Hauser
exon 6 471 ctcctgccttagcctcctgag /
ggaggatggcagagccagaatt		   Hauser
exon 7 330  tctgccatctccttgtgtttt / 
tgaagtctgctgggcttttc		   Hauser
exon 8 380 ggtataacaaaatagtactgcatgtc / aactggattcacccaaataaac   Hauser
exon 9 286 tggtcagagacatccacttca /
ttttatactctgctgggattttca		   Hauser
exon

(CDS)		 10a 420  ccaatttggttagaacaggttt /
GTAGGCTTCACAAATCGGAG		   Hauser
10b 522  TACCAACATTGGAAAACAG /
tcataggttttgctgagtggag		   Hauser

Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and added primer tails in italics. Amplified: region amplified. Numbering of exons is according to genomic sequence AC004820 compared to the cDNA, with the first base of the Met-codon counted as position 1 (see Reference Sequence). Length: length of PCR-product in basepairs. Forward primer / reverse primer: sequence of forward and reverse primer (primers were used by Hauser et al. (2002)) for DHPLC analysis. Name: name of the primers. Reference: publication describing the primer(s).

RNA-primers

none reported

Amplified Length Forward primer Reverse primer Name Reference
           

Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and added primer tails in italics. Amplified: region amplified (cDNA sequence from GenBank AF133820). Length: length of PCR-product in basepairs. Reference: publication describing the primer(s). Forward primer: sequence of forward primer. Reverse primer: sequence of reverse primer. Name: name of the primers.

myotilin sequences

| Top of page | LMDp homepage |
| Muscular dystrophies |
| Remarks / information | Copyright©, liability |