Titin-cap (telethonin) (TCAP) - coding DNA reference sequence

(used for mutation description)

(last modified December 1, 2010)

This file was created to facilitate the description of sequence variants in the TCAP gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008892.1, covering TCAP transcript NM_003673.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5014
                                               aatgaggagtgatc       c.-1

          .         .         .         .         .         .       g.5074
 ATGGCTACCTCAGAGCTGAGCTGCGAGGTGTCGGAGGAGAACTGTGAGCGCCGGGAGGCC       c.60
 M  A  T  S  E  L  S  C  E  V  S  E  E  N  C  E  R  R  E  A         p.20

          .         .         .         .         . | 02       .    g.5380
 TTCTGGGCAGAATGGAAGGATCTGACACTGTCCACACGGCCCGAGGAGGG | CTGCTCCCTG    c.120
 F  W  A  E  W  K  D  L  T  L  S  T  R  P  E  E  G  |  C  S  L      p.40

          .         .         .         .         .         .       g.5440
 CATGAGGAGGACACCCAGAGACATGAGACCTACCACCAGCAGGGGCAGTGCCAGGTGCTG       c.180
 H  E  E  D  T  Q  R  H  E  T  Y  H  Q  Q  G  Q  C  Q  V  L         p.60

          .         .         .         .         .         .       g.5500
 GTGCAGCGCTCGCCCTGGCTGATGATGCGGATGGGCATCCTCGGCCGTGGGCTGCAGGAG       c.240
 V  Q  R  S  P  W  L  M  M  R  M  G  I  L  G  R  G  L  Q  E         p.80

          .         .         .         .         .         .       g.5560
 TACCAGCTGCCCTACCAGCGGGTACTGCCGCTGCCCATCTTCACCCCTGCCAAGATGGGC       c.300
 Y  Q  L  P  Y  Q  R  V  L  P  L  P  I  F  T  P  A  K  M  G         p.100

          .         .         .         .         .         .       g.5620
 GCCACCAAGGAGGAGCGTGAGGACACCCCCATCCAGCTTCAGGAGCTGCTGGCGCTGGAG       c.360
 A  T  K  E  E  R  E  D  T  P  I  Q  L  Q  E  L  L  A  L  E         p.120

          .         .         .         .         .         .       g.5680
 ACAGCCCTGGGTGGCCAGTGTGTGGACCGCCAGGAGGTGGCTGAGATCACAAAGCAGCTG       c.420
 T  A  L  G  G  Q  C  V  D  R  Q  E  V  A  E  I  T  K  Q  L         p.140

          .         .         .         .         .         .       g.5740
 CCCCCTGTGGTGCCTGTCAGCAAGCCCGGTGCACTTCGTCGCTCCCTGTCCCGCTCCATG       c.480
 P  P  V  V  P  V  S  K  P  G  A  L  R  R  S  L  S  R  S  M         p.160

          .         .                                               g.5764
 TCCCAGGAAGCACAGAGAGGCTGA                                           c.504
 S  Q  E  A  Q  R  G  X                                             p.167

          .         .         .         .         .         .       g.5824
 gagggactgtgacttgggctccgctgtgcccgccctgggctgggcccttcctggctagga       c.*60

          .         .         .         .         .         .       g.5884
 ctgtggaggggagctgctggccatggctgctttgtagtttgcccagagttgggggctagg       c.*120

          .         .         .         .         .         .       g.5944
 ggaggggggagccagaggccaggatgcctgagccccctgagttcccaaagggagggtggc       c.*180

          .         .         .         .         .         .       g.6004
 agagacagtgggcactaagggtggagagttgggggccagcacagctgaggaccctcagcc       c.*240

          .         .         .         .         .         .       g.6064
 ccaggagaagggacaaaaggtactggtgagggcaagaggtgcctgggaggagtggccctg       c.*300

          .         .         .         .         .         .       g.6124
 atccaggaaaatgtgaggggaatctggaacgctctaggcagaagaagctgggagggaggg       c.*360

          .         .         .         .         .         .       g.6184
 ggaggtgaaaagggcagaggcaaggatggtggggcccccagcaccctctgttagtgccgc       c.*420

          .         .                                               g.6209
 aataaatgctcaatcatgtgccaga                                          c.*445

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Titin-cap (telethonin) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.