Leiden Muscular Dystrophy pages

Myotilin (MYOT)

( LGMD-1A, myotilinopathy, MFM )

(last modified February 19, 2006)


Contents



Summary


The myotilin gene was first described as a gene showing a similarity to the Ig-like domains of titin. The myotilin gene (MYOT, aliases TiTin Immunoglobulin Domain [TTID] protein gene), contains 10 exons spread over 18 kb. MYOT maps to chromosome 5q31 between markers AFM350yB1 and D5S500. The MYOT gene is expressed in multiple muscle tissue types, including skeletal and cardiac muscle, as well as in thyroid gland and bone marrow. Myotilin is a 57 kDa cytoskeletal protein containing a unique N-terminal sequence and a C-terminal half which contains two Ig-like domains similar to titin. Myotilin co-localizes with alpha-actinin in the sarcomeric I-bands (Z-line) and directly interacts with alpha-actinin. Myotilin mapped to the candidate gene region for LGMD-1A and a new type of distal myopathy with vocal cord and pharyngeal weakness (VCPMD). Hauser (2000) showed that myotilin is mutated in a large North American LGMD-1A family of German descent. The change, 450C>T (Thr57Ile), was found in all patients and not in 396 control chromosomes. Recently, the same group identified a second myotilin mutation (164C>T / Ser55Phe) in an Argentinian family (Hauser et al., 2002).


The myotilin gene


Links to other databases:
HGNC Gene Symbol   EntrezGene    OMIM Gene Map   GDB

The myotilin gene was first described by Godley (1999), as a gene showing a similarity to the Ig-like domains of titin. The myotilin gene (HGNC Gene Symbol MYOT, alias TiTin Immunoglobulin Domain [TTID] protein gene), contains 10 exons spread over 18 kb. MYOT maps to chromosome 5q31 between markers AFM350yB1 and D5S500 (Godley, Salmikangas).

The gene is flanked 57 kb upstream by the NPY6R pseudogene (neuropeptide Y receptor Y6) and 116 kb centromeric the HNRPA0 (heterogeneous nuclear ribonucleoprotein A0, opposite transcription) gene. Directly 3' (1.5 kb) of MYOT lies the PKD2L2 (polycystic kidney disease 2-like 2) and 50 kb 3' C5orf5 (chromosome 5 open reading frame 5, opposite transcritpional direction) gene.

Exon Exon size (bp) Intron size
(in bp)
5' cDNA position Splice after Remarks
1 (83) 2,487 -305 - 5' UTR
2 567 4,821 -211 2 5' UTR / 356 bp coding
3 175 1,516 357 0  
4 102 3,194 532 0  
5 50 1,107 634 2  
6 133 1,278 684 0  
7 208 2,456 817 1  
8 166 650 1025 2  
9 134 215 1191 1  
10 641 - 1325 - 173 bp coding / 3' UTR

Legend:
Exon: numbering of exons and intron/exon boundaries are according to genomic sequence AC106791.4, compared to the cDNA with the first base of the Met-codon counted as position 1 (see coding DNA Reference Sequence). Exon size: size of exon indicated in basepairs. Intron size: size of intron indicated in kilobasepairs. 5' cDNA position: first base of the exon. Splice after: splicing occurs in between of two coding triplets (0), after the first (1) or the second (2) base of a triplet. Remarks: 5' UTR = 5' untranslated region, 3' UTR = 3' untranslated region.

primers for DNA-amplification


The myotilin mRNA


Links to other databases:     UniGene: Hs.84665    RefSeq: NM_006790

The MYOT gene is expressed in multiple muscle tissue types, including skeletal and cardiac muscle, and in thyroid gland and bone marrow. Northern blot analysis (Godley 1999) showed highest expression levels in muscular tissues (skeletal and cardiac), thyroid gland and bone marrow. The transcript of detected measured ~2.6 kb and was also present in mRNA from K562 cells (a cell line derived from malignant cells of a chronic myelogenous leukemia patient). Smaller transcripts were seen in skeletal muscle and bone marrow
(~2.4 kb) and in cardiac muscle (~1.8 kb).

primers for RNA-amplification


The myotilin protein


Links to other databases:   RefSeq: NP_006781

Myotilin (MYOT) is a 57 kDa cytoskeletal protein of 498 amino acids (calculated molecular weight 55.395 kDa). The N-terminal sequence of myotilin is unique and not homologous to any other protein. It includes a 23-residue hydrophobic domain (aa 57-79) and a region rich in serine (aa 28 - 124, 27/96 residues). Although the function of this domain is unknown, it is possible that the hydrophobic stretch mediates the localization of small amounts of myotilin protein to the sarcolemmal membrane. MYOT interacts with alpa-actinin, the binding site was localized between MYOT aa 79-150 (Hauser et al. 2000). The C-terminal half contains an internally repeated domain which resembles the N-terminal half of the Ig-like domains 7 and 8 of the giant muscle protein titin (TTN, aa 248-291 and 348-390). 

Myotilin is a Z-disk component that interacts with alpha-actinin (Salmikangas 1999), gamma-filamin (FLNC, van der Ven 2000) and actin (Salmikangas 2003) and plays a role in myofibrillar assembly (Salmikangas 2003). Yeast two-hybrid experiments mapped the minimum alpha-actinin binding domain from amino acids 79-150 (Hauser 2000) and the gamma-filamin binding site to within the C-terminal Ig domains of myotilin (aa 215-493, van der Ven 2000). gamma-filamin colocalizes with alpha-actinin in the Z-disk in striated muscle and has been implicated in Z-disk assembly and myofibrillogenesis (van der Ven 2000). 

myotilin antibodies


myotilin and disease: LGMD-1A


Links to other databases:   OMIM:    159000 (LGMD-1A),   609200 (myotilinopathy),    601419 (MFM)

LGMD-1A ( OMIM-159000) is a dominant disease with adult onset which was mapped to 5q22.3-q31.3 (Speer et al. 1992). Symptoms include a progressive weakness of the hip and shoulder girdles, as well as a distinctive dysarthric pattern of speech. Muscle of affected individuals shows degeneration of myofibers, variations in fiber size, fiber splitting, centrally located myonuclei and a large number of autophagic vesicles. Affected muscle also exhibits disorganization and streaming of the Z-line similar to that seen in nemaline myopathy.

Initially, Salmikangas et al., (1999) showed that myotilin mapped to 5q31, in a narrow segment containing the candidate gene region for a dominantly inherited limb-girdle muscular dystrophy (LGMD-1A) and a new type of distal myopathy with vocal cord and pharyngeal weakness (VCPMD). Shortly later, Hauser et al. (2000) showed that myotilin is mutated in a large North American LGMD-1A family of German descent. The gene contained a 450C>T change predicted to cause a conversion of residue Threonine-57 to Isoleucine. The gene was found in all patients and not in 396 control chromosomes. Since the mutant allele was transcribed normally, LGMD-1A muscle contained normal levels of correctly localized myotilin and the missense change did not disrupt binding to alpha-actinin, the disease-causing effect of the mutation remained uncertain. Later, upon screening of an additional 86 families with a variety of neuromuscular pathologies, Hauser et al., (2002) identified a second change in the myotilin gene (164C>T / Ser55Phe) in an Argentinian family. Both of the observed myotilin mutations would have the effect of elongating the hydrophobic N-terminal sequence, possibly disturbing its interactions with the sarcolemmal membrane or with a n unknown binding partner Hauser et al., (2002).

Hauser et al., (2002) note striking similarities between LGMD1A and the nemaline myopathies, suggesting possible mechanisms by which myotilin mutations may give rise to disease. Myotilin and alpha-tropomyosin (NEM1) both bind to alpha-actinin. Missense mutations in alpha-tropomyosin give rise to nemaline myopathy (Laing et al. 1995), with Z-line streaming similar to that seen in LGMD1A. A primary roles of alpha-actinin is to tether actin filaments to the Z-line, and missense mutations in alpha-actin also give rise to nemaline myopathy (Nowak et al. 1999).

Myotilinopathy (OMIM-609200); MFM - myofibrillar myopathy (OMIM-601419), refers to a group of morphologically homogeneous, but genetically heterogeneous chronic neuromuscular disorders. Morphologic changes in skeletal muscle result from disintegration of the sarcomeric Z-disc and the myofibrils, followed by abnormal ectopic accumulation of multiple proteins involved in the structure of the Z-disc (OMIM). Upon analysis of 63 unrelated MFM patients, Selcen & Engel (2004) identified 4 different MYOT-mutations in 6 patients (4 others carried a desmin [DES, OMIM-601419] and 2 an alpha-B crystallin [CRYAB, OMIM-608810] gene mutation). The MFM patients had peripheral neuropathy, cardiomyopathy and distal weakness greater than proximal weakness are part of the spectrum their myotilinopathy. Selcen & Engel (2004) suggested to call this phenotype Myotilinopathy (OMIM- 609200). In a large 5-generation family Foroud (2005) mapped SBM (spheroid body myopathy) to 5q31 (D5S2117), considered the MYOT-gene as a candidate and ultimately identified a c.116C>T (p.Ser39Phe) change in all affected family members.

myotilin sequence variations (mutations and polymorphisms)


Miscellaneous


DNA-primers

Amplified Length Forward primer /
reverse primer
Name Reference
exon 2a 546 cagatctgaaagatgtcaaataaacaa /  GTTGTAACCCTTTGGCCTGG   Hauser 2002
2b 481 CTCAACAAGGAAGAGCAGAC / TACTGCTATTGTAATCAGGC   Hauser 2002
2c 476  GCTCCAGATTGCAGCCTCCT / ccagtaccctggttcagcat   Hauser 2002
exon 3 373 atttgcaaaatgaggccaag /
gggcccaaatattccttctt
  Hauser 2002
exon 4 273 tgtctcaataaattctctaaagcg / gtggatggaactgaccgact   Hauser 2002
exon 5 462  ctgggcttcttgctagagtggtag / 
gatcctggcttatttgacc
  Hauser 2002
exon 6 471 ctcctgccttagcctcctgag /
ggaggatggcagagccagaatt
  Hauser 2002
exon 7 330  tctgccatctccttgtgtttt / 
tgaagtctgctgggcttttc
  Hauser 2002
exon 8 380 ggtataacaaaatagtactgcatgtc / aactggattcacccaaataaac   Hauser 2002
exon 9 286 tggtcagagacatccacttca /
ttttatactctgctgggattttca
  Hauser 2002
exon

(CDS)
10a 420  ccaatttggttagaacaggttt /
GTAGGCTTCACAAATCGGAG
  Hauser 2002
10b 522  TACCAACATTGGAAAACAG /
tcataggttttgctgagtggag
  Hauser 2002

Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and added primer tails in italics. Amplified: region amplified. Numbering of exons is according to genomic sequence AC106791.4 compared to the cDNA, with the first base of the Met-codon counted as position 1 (see coding DNA Reference Sequence). Length: length of PCR-product in basepairs. Forward primer / reverse primer: sequence of forward and reverse primer (primers were used by Hauser 2002) for DHPLC analysis. Name: name of the primers. Reference: publication describing the primer(s).


RNA-primers

Amplified Length Forward primer /
reverse primer
Name Reference
1-3 706 ATGCCTCTTCCTTCCCTTCA /
AGTTCTTGGTATGGGCTTAG
  Godley 1999
2-3 410 CTCAACAAGGAAGAGCAGAC /
GTTGTAACCCTTTGGCCTGG
  Hauser 2000
3-7 667 GTAAAATCCCTTCCGCTATG /
GCTTCTCCTGCTCTATTCTTG
  Godley 1999
7-10 961 GCCAAGAATAGAGCAGGAGAA /
TTTGACATACAACTGTGGAAC
  Godley 1999

myotilin sequences




| Top of page | LMDp homepage |
| Muscular dystrophies |
| Remarks / information | Copyright, liability |