Leiden Muscular Dystrophy pages

FKRP amplification primers

( LGMD-2I / MDC1C )

(last modified January 13, 2005)


Contents


DNA-primers  -  gene

Amplified Location Length
(in bp)
Reference forward primer reverse primer Name
exon 1 -867 - -267 601 Walter ttacacagccctccttccg gccgccatcttggagcaat PRO 1S/1R
exon 4 -39-131 - 232 403 Louhichi caaagctgaaaccaaataggga GCTGGGCTGGGTCTTGCTG FKRP 4-1
exon 4 -39-105 - ... 1,697 Brockington aaagggaattgagaaagagc GCTCACACAGAGCTTCTCC FKRP-1F/5R
exon 4 -39-105 - 214 281 Brockington, Walter aaagggaattgagaaagagc GCAGGAAGGAGTCTACCAG FKRP-1F/1R
exon 4 137 - 545 409 Louhichi GCCCCCGTGTCACCGTCCT TAGCGGGCGGTCCACTCTC FKRP 4-2
exon 4 167 - 634 468 Brockington, Walter TCGAGGCATTTGACAACGCGG CCGAGAGGTTGAAGAGGT FKRP-2F/2R
exon 4     Brockington   CTCCTCGTAGAGGTAGGC FKRP-3R
exon 4 375 - 885 511 Louhichi TGTGGCCCTAGTACCTGATG GCGCGTGGTCTCCTTGTTG FKRP 4-3
exon 4 658 - 870 213 Walter ACCAGCCTCTTTCTGCAGACC TGGAGTGGTTCGGCTGCAAC FKRP-3F/3R
exon 4 827 - 1272 446 Louhichi TAGTGAGCTGGGAAGGCGG ATTGCGGGGGTAGAAGGG FKRP 4-4
exon 4 1099 - 1189 91 Brockington, Walter ATCTACTTGGAGGACGTGGGCAA CCTTCTCCCATACGAAGC FKRP-4F/4R
exon 4 1215 - 1636 421 Louhichi GCAGTACAGCGAAAGCAACC GCCTTCTCTCATGCTCTCCT FKRP 4-5
exon 4
826C>A
mutation
   573 Brockington ACCTCTTCAACCTCTCGG* CCTTCTCCCATACGAAGC FKRP-2F/4R
(digest with BfaI,yielding 400 and 500 bp fragments)

Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and added primer tails in italics. Amplified: region amplified; numbering of exons is according to Brockington. Location: region amplified, nucleotide numbering according to the coding DNA reference sequence. Length: length of PCR-product in basepairs. Reference: publication describing the primer(s). Forward primer: sequence of forward primer. Reverse primer: sequence of reverse primer. Name: name of the primers.
*NOTE: sequence of this primer was published as reverse (Brockington).


CA-repeats

Marker Length
(in bp)
Location
(in Mb)
Forward / reverse primer Name Reference
D19S219
(AFM210yg9)
174 +1.26  gtgagccaagattgtgcc /
gactatttctgagacagattccca
  GenBank Z23600
D19S412
(AFM284yg5)
113 +0.24 tgagcgacagaatgagact /
acatcttactgaatgcttgc
  GenBank Z24042
fkrp52 92 - 122
(120 = CA26)
+0.04 tctccaaaaaacaacaacaac /
ctagtgttctgggaccttt
  Louhichi [2004]
FKRP   0 ccaacacactgtctgcctt    
D19S606
(AFMb030we1)
178
(= AC20)
-0.72 agggctgggacctca /
ccaacacactgtctgcctt
  GenBank Z53152

Legend:
Marker: name of DNA CA-repeat marker (with link to GDB). Length (in bp): length of PCR-product in base pairs. Forward / reverse primer: sequence of forward and reverse primer. Reference: publication describing the primer(s). Name: name of the primers.


RNA-primers

Amplified Length Reference Forward primer Reverse primer Name
           

Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and added primer tails in italics. Amplified: region amplified. Numbering of exons is according to.... Length: length of PCR-product in basepairs. Reference: publication describing the primer(s). Forward primer: sequence of forward primer. Reverse primer: sequence of reverse primer. Name: name of the primers.



| Top of page | LMDp homepage |
| FKRP homepage | FKRP sequence variants  |
| Remarks / informationCopyright, liability |