Leiden Muscular Dystrophy pages

DMD amplification primers

( DMD / BMD )

(last modified December 23, 2008)


Contents


Quantitative multiplex PCR

Stockley et al. (2006) reported a quantitative multiplex PCR assay developed to detect deletions and duplications in all 79 exons of the DMD gene and the brain promoter (Dp427c). The assay consists of 10 separate multiplexes, each with 7 to 9 nons-equential exons.

Multiplex set A

Exon Sequence forward / reverse primer Length (bp) Primer conc. (uM)
34 GTAACAGAAAGAAAGCAACAGTTGGAGAA /
CTTTCCCCAGGCAACTTCAGAATCCAAA
171 0.8
78 GGAAAGCCAATGAGAGAGGTTAGTGAGA /
CAATGAGCTGCAAGTGGAGAGGTGACTAC
179 0.8
42 CACACTGTCCGTGAAGAAACGATGATGG /
CTTCAGAGACTCCTCTTGCTTAAAGAGAT
195 0.2
64 TATTTCTGATGGAATAACAAATGCTC /
CCCTCTCTAAGTAAAAATGTACCC
209 0.3
16 TCTATGCAAATGAGCAAATACACGC /
GGTATCACTAACCTGTGCTGTACTC
290 0.2
2 AAACCAGCATCACTCATGTTTAATTC /
CGGATTTTTAAGATACACAGGTACATA
306 0.5
53 GTCTCCTCCAGACTAGCATTTACTACTA /
TGGTATAATTTTATCAAATGTAACCAGT
327 1.4

Multiplex set B

Exon Sequence forward / reverse primer Length (bp) Primer conc. (uM)
62 CTTTCCTGTTTGCGATGAAT /
ACAGGTTAGTCACAATAAATGCTCT
174 0.08
70 TGGTCATTAGTTTTGAAATCATCC /
TATACATCAAACAAGAGTGTGTTCTG
241 0.4
38 AAATGTATTTCTTTTGGTTTATGTTTC /
TTCAGTTGGAGACTTATCTAAGTTCT
280 0.6
7 TAAAGGGTAAATGAATTACACTCAAG /
CCATACTAAAAGCAGTGGTAGTCCAG
303 0.24
14 AGCGTACATAGGAGACTGAGATACTT /
GCAAGACATTAAAGAATTCCAAG
313 0.2
46 GTTTGTGTCCCAGTTTGCATTA /
AAACACTTTAGCAAGGAACTATGAAT
353 0.8
23 TCAGTTAATTTCACTAAAACTCATCAA /
AGATGCTGAAGGTCAAATGCTTA
393 2
54 AAGTTTGTCCTGAAAGGTGGGGTTA /
AGTTTCACCACCCCATTATTA
405 0.8

Multiplex set C

Exon Sequence forward / reverse primer Length (bp) Primer conc. (uM)
74 AAATACACTCCTGAGTCCCTAACCC /
TGCATACCAATGACAAAGCTAGAAA
272 0.6
47 CCTCGGTCAAGTCGCTTCAT /
CATGTGACGGAAGAGATGGTTAATG
290 0.2
3 AGGGGATAATCGTGAAAATGTAT /
CGAGGTTGCTTTACTAAGGAATAGG
309 0.2
22 GGCAAAGTGTGAAACAATTAAGTG /
TGGGCAAACTACCATACTTGTCAGAAT
317 1.2
13 TAGCAGAAAATTGGCTTGGAATG /
TTCAAGTTATAGTTCTTTTAAAGGACATA
330 0.6
58 GGAGTTTCATAAACAAGTTCTGAG /
GCATCTATGTTTAATTTGAATTGATT
356 0.24
67 TGGCTACTCTTGAGAATTGCTACTG /
CTGCCTACTGAAGAGCTAATATGAGA
369 1
37 CACACGCATTTTCATTTTAGTCCTG /
CTTCGCAAGAGACCATTTAGCAC
440 0.04

Multiplex set D

Exon Sequence forward / reverse primer Length (bp) Primer conc. (uM)
43 CTCAGGTCGGATTGACATTATTC /
GCAAGTATCAAGAAAAATATATGTGTTA
180 0.6
71 GGCTGAGTTTGCGTGTGTC /
GAAATGAAGGAAGGGGAATTA
226 0.2
11 AAAATAAAACTCAAAAACCACACCG /
TTGTTTTTCCATGCTAGCTACCC
249 0.16
60 ACAAACATTCAAACCGTAGCATA /
TTATTTTACTGTAACAAAGGACAACAAT
322 0.7
50 TTAAAAGAAATTCTACCCACTAAAGTT /
CTCTCTCACCCAGTCATCACTTCATA
337 0.7
21 TTGCCTTACTGCTTTTTAATACCT /
TGTTAGTACCTTCTGGATTTCCC
348 0.3
40 TGTACAAAAAAGATGAGGGACG /
ACAACACACAATACAAGGAAATGC
399 0.3
30 TCATGCAGAGATCCCTGATCCTATA /
GAAGCTGATTCCCAGATGTACTT
412 0.8
Dp427m
/ exon 1
GCTGGAAGCACAACCTTATATGTAG /
CACAAACTAAACGTTATGCCAC
460 0.4

Multiplex set E

Exon Sequence forward / reverse primer Length (bp) Primer conc. (uM)
61 CAGTCTTGGAGACTCAAAGTATCTTATC /
AATCAAGATGCAATAAAGTTAAGTG
229 0.8
72 TGTGTGGTGGGTTTTTTCTCCATT /
AGTAGGAATCAGACAAGTTTGGG
250 0.2
4 TTCATTTCTAGTAGATTGTCGG /
TCAGGCATACACGAATTACAACAT
300 0.2
31 TAAAGGAAGCTACATGGTAGAGGTG /
AAATCCAATCTTGCCAATAATC
318 0.2
24 ACATCCTTTAAACATGGGAATTGT /
GGGAGAGGAGAGCAAAATCCAC
331 0.2
41 AAAGGATGACAATAAAGGGACAACA /
GTAGTTGCAAACACATACGTGGGT
344 0.8
12 GCTTTCAAAGAGGTCATAATAGGCT /
CCTGAATTTTGGAGGGGACTTA
392 0.8
51 GTTTGGCTCAAATTGTTACTCTTCA /
AAAGTGATTGGTGGAAAATCTTCAT
429 1

Multiplex set F

Exon Primer Sequence forward / reverse primer Length (bp) Primer conc. (uM)
63 TTTTTCCTGTTTTCTTGACTACTCAT /
GCCATGTCCTTACCTAAAGACTG
140 0.4
73 CATAAGTTTAATGAGCTTTTACGTT /
CCCTCAAAGCAATTTCATTGTCAG
157 0.4
15 AAATTGGAAAAGTAAAGATTTATGTT /
GGGTTTTTATAAGACCATTGAA
207 0.4
5 TAGGCATTTGGTCTCTTACCTTCAA /
CTATGGAGCAGGGTTTGTTATTGTTAG
258 0.8
52 ATTATGTAAAAGGAATACACAACGC /
TATAAATGTGAGGGGGATATA
273 0.4
32 ATAGGACCAGTTATTGTTTGAAAGG /
CTTAATGAGGAAAGTCAAGGG
290 0.4
25 ATGCCATCAGTCCCAATTTTACATT /
AAAGCCTTAACCAAAAGTAACGGTG
346 0.3

Multiplex set G

Exon Sequence forward / reverse primer Length (bp) Primer conc. (uM)
33 GGGATCTCTATTTATTTCTGTTCATA /
AAAGTGGAAAGAAGTGTTTGTGGTC
281 1.2
65 AAAGGACACTGAAAGGAAGGTTTTACT /
CGGGAAATAAAAACATGCCATAC
292 0.2
Dp427c GACTGACGTATCAGATAGTCAGAGT /
TAATCCTACCTTCCATGCCAGCTGT
303 0.4
45 TTTGTTTTGCCTTTTTGGTATC /
TAGTGCCTTTCACCCTGCTTATA
308 0.3
26 ATGTTTCATCACTGTCAATAATCGTGTT /
TAGAACCAGGAAAGAGCAGACTGTAT
329 1.2
75 TTCTTTTTTACTTTTTTGATGCC /
TAGAACCAGGAAAGAGCAGACTGTAT
347 0.2
55 AGTTCCTCCATCTTTCTCTTTTTATG /
TGTTTTGTCCCTGGCTTGTCA
371 0.4
6 AATGAATCAGAATAGACTCCTAGCCTT /
CATACTGGGGAAAAATATGTCATC
437 0.4
17 ACAATTTTATTTGGCTTCAATATGG /
GACATTACAGGTACCCGAGGATT
448 0.4

Multiplex set H

Exon Sequence forward / reverse primer Length (bp) Primer conc. (uM)
44 CTTGATCCATATGCTTTTACCTGCA /
TCCATCACCCTTCAGAACCTGATCT
268 0.2
76 CAAAATTTATGAGTCCTGAGTGTGTAT /
ACGACTCTACCTTTCTTCAGACAAC
274 0.14
35 GCCGTTTCATAAGCATTAAATC /
TATGTATCTTTTTCTCGTGACAGA
308 0.24
18 AGGGAAAATAGTGCTGCTATTAATACTA /
GCAGCAAAATGAGTACAGATATA
320 0.8
66 TTTTCAAGGCTTTATTCTTAACTAGA /
GCCTGCAATTTAATGTTTGACAA
353 1.6
27 ATTTATGGAAGAGACTGGAGTTCAT /
TGACAAAGACCAAGAAAAGCAAC
364 0.16
56 CACATATTCTTCTTCCTGCTGTC /
TCCTCAAGTATCATCTCCATACC
384 0.12
10 ATAATGCCAGTGGACAGTCCTA /
GAATCCCAAGCACATCATAGTAACT
436 0.2

Multiplex set I

Exon Sequence forward / reverse primer Length (bp) Primer conc. (uM)
77 TTTTCCATTATTTGTTTTTGCTTTT /
TGCCATTCTGATACTGCGTGTT
240 0.3
57 ACACTTCTAGATATTCTGACATGGT /
TAGTCACTGGATTACTATGTGCTT
262 0.2
68 ATCTTGCCTTCTTTCCTTTCATC /
AGCAACTGGCACAGGAGATAAA
317 0.6
36 ATGAAAATACCACTTAAAACTAATCTCA /
GACAAAGATGATTGAAGTAACTGGTG
323 1.4
19 TCACAGTCCTTGTATTGAATTACTCA /
CTTCCAATGAACTCAAAGTTGAA
332 1.4
9 CTTTCGGGTTACTTATGGTT /
AGCAGAATCACATGAGGGAATCAA
348 0.4
28 TGCATTTTGAATTACCTGCTACA /
CTTTGGATTTGTCTTCTATTTGGTACT
360 0.6
48 TATGCCTTGTGAATTATTTACCTTTT /
CCCTGTGCCTATTGTGGTTATCCT
389 0.4

Multiplex set J

Exon Sequence forward / reverse primer Length (bp) Primer conc. (uM)
69 AATACATACGTGTTTGTTTTTGCTCTT /
ATTTATCCCAGGTGAACTAACTCTCA
195 0.6
39 ACCAAAATGAAGACTGTACTTGTTGT /
AAACCACAGGCAAGGTATATTATA
214 0.6
29 TTGCTGATAATCCAATGTATTTAGAA /
ATGCAAATTAGATTAAAGAGATTTT
255 1.2
20 CTGTGGGTTCAGGGGATATA /
TGCCAAGAAATACCTATTGATTATG
339 0.4
49 CTACATTTTTGTGCCCTTATG /
GCTTTGCCTCTGCTATTACAGTATG
385 0.16
8 ACTCGTGATCTCATTGGTCTGC /
ACATCTTGAATAGTAGCTGTCCTTT
420 0.3
59 GGTTACCCTCTTGTTCAACTGTACT /
CACTCAAGTTCAGATTAGAAGCTC
446 0.3
79 TTTCTCTTTGTTTTCCAGGACACA /
TGTTTTGTTTTTAGGGGTTTT
488 1.4

Legend:
NOTE: sequences were not checked.
Sequences were derived from Stockley et al. (2006). All forward primers were labeled with FAM, reverse primers were unlabeled. Migration of amplification products may vary slightly (1-3 bp) due to differences in equipment and polymers used. Exon: exon number. Sequence forward / reverse primer: sequence of the forward and reverse primer for PCR. Length (bp): length of the amplification product (in basepair). Primer conc.: concentration of the DNA primers (in uM).



| Top of page | LMDp homepage |
| Remarks / informationCopyright, liability |