Leiden Muscular Dystrophy pages

Primers for DMD RNA RT-PCR

(last modified September 7, 2012)


Several sets of primers for RT-PCR amplification of DMD RNA have been published. Below primers are shown that have been used in combination with direct sequecing of the cDNA for point mutation detection. Several other sets of primer sequences, used in combination with DMD PTT-analysis, can be found here. Note that DMD transcription can be induced using myoD-induced myodifferentiation.


cDNA sequencing

Exons Name Length
(in bp)
Forward / reverse primer
1 - 4 21F 408 CTACAGGACTCAGATCTGGG /
GGGCATGAACTCTTGTGGAT
428R
1 - 4 44F 385 CAATTACCTTCGGAGAAAAACG /
GGGCATGAACTCTTGTGGAT
428R
3 - 6 305F 422 GGGAAGCAGCATATTGAGAA /
ATGAGAGCATTCAAAGCCAG
726R
6 - 9 621F 517 AGATTCTCCTGAGCTGGGTC /
GAGGTGGTGACATAAGCAGC
1137R
8/9 - 11 1030F 402 TTCTCAACAGATCACGGTCA /
CCAATCAGCTTACTTCCCAA
1431R
10/11 - 13 1355F 349 GAGGGGTACATGATGGATTTG /
GACCCTGACTTGTTCTTGTT
1729R
12/13 - 15/16 1682F 351 CAACATAAGGTGCTTCAAGA /
CGCTTTTAAAACGGCCAGTT
2030R
15 - 17 1985F 358 CAAAATGAAATGTTATCAAG/
TCTTCTTTTGGGGAGGTGGT
2342R
17 - 20 2300F 349 ATGCTCAAGAGGAACTTCCA /
CGATCCACCGGCTGTTCAGT
2648R
20 - 21 2603F 350 GATAGCATCAAACAAGCCTC /
GTAAAGGCCACAAAGTCTGC
2952R
21 - 23 2909F 380 GGACAAGGACCCATGTTCCT /
CCGGCTAATTTCAGAGGGCG
3256R
23 - 25 3187F 370 AAGTGG C CTATACTATCTCAG /
CTTTATCTTCTGCCCACCTT
3556R
23 - 25 3207F 350 GCACCACTGTGAAAGAGATG /
CTTTATCTTCTGCCCACCTT
3556R
25 - 27 3487F 373 TTTAGTCAGTGATATTCAGAC /
GGAGTTTCACTTTCGCTTCT
3857R
25 - 27 3507F 351 CAATTCAGCCCAGTCTAAAC /
AAGGAGTTTCACTTTCGCTTC
3859R
27 - 29 3813F 348 GAGCTAAAGAAGAGGCCCAA /
CCTCTGAATGTCGCATCAAA
4160R
28/29 - 31 4114F 351 CTCTGAGGTGCTAGATTCAC /
CTTGTCAAATCAGATTGGAT
4464R
30 - 33 4418F 365 GCTCAAA . TGCCTCAGGAAGC /
GTCTTTATCACCATTTCCAC
4782R
33 - 35 4740F 351 GTCTGAGTGAAGTGAAGTCT /
GGTGCACCTTCTGTTTCTCA
5090R
34/35 - 37 5043F 351 CCTGGGGAAAG G CTACTCAA /
GGCGTATGTCATTCAGTTCT
5393R
36/37 - 39 5348F 353 GAAGACGTGCTTAAGCGTTT /
CCTCTTTGCAACAATTCTTT
5700R
38/39 - 41 5656F 351 GAATGAAGACAATGAGGGTA /
GCTTGCCTACGCACTGCATT
6006R  
41 - 42 5959F 350 GGAATTGCAGAAGAAGAAAG /
GCTTAAAGAGATCTTCAAAG
6308R  
42 - 44 6237F 388 GCCCTATTAGAAGTGGAACAAC /
GCATGTTCCCAATTCTCAGG
6624R
42 - 44 6262F 363 CAATGCTCCTGACCTCTGTG /
GCATGTTCCCAATTCTCAGG
6624R
44 - 46 6578F 350 GAACAGTTTCTCAGAAAGAC /
GGTTCAAGTGGGATACTAGC
6926R
46 - 48 6883F 350 ATGGTTGGAGGAAGCAGATA /
GCAGCAGATGATTTAACTGC
7232R
48 - 50/51 7177F 351 TGGGCAGCTTGAAAAAAAGCT /
GAGTAGGAGAGGCTCCAATA
7526R
50 -52 7481F 331 CCTGACCTAGCTCCTGGACT /
GGGCAGCGGTAATGA GTTCT
7811R
52 - 54 7762F 351 AGGATTTGGAACAGAGGCGTC /
GTCTGCCACTGGCGGAGGTC
8112R
53 - 55 8038F 376 GGAGGGTCCCTATACAGTAG /
CATCAGCTCTTTTACTCCCTT
8413R
53/54 - 55 8068F 346 CACAGAAACCAAGCAGTTGG /
CATCAGCTCTTTTACTCCCTT
8413R
55 - 57 8360F 347 GCTACCCGTAAGGAAAGGCT /
GGTGCCTGCCGGCTTAATTC
8706R
57 - 59 8660F 346 CTGGTGTGGCTACAGCTGAA /
GGGTCTCATCTATTTTTCTC
9005R
59 - 60/61 8952F 351 GGGAAAAATTGAACCTGCAC /
CGACGGCCACCTGCAGAAGC
9302R
59/60 - 64/65 9143F 439 AAGGCACTTCGAGGAGAAAT /
TCAAGAGATCCAAGCAAAGG
9581R
63 - 67 9458F 428 GACCATCCCAAAA . TGACAGA /
GTTGAACTTGCCACTTGCTT
9885R
65 - 69 9751F 477 GCTGCTGAATGTTTATGATA /
CAGCTTTGGCAGATGTCATA
10227R
68/69 - 74 10164F 468 GTCCAATCATTGGATTCAGG /
AATGCTGGATTAACAAATGT
10631R
72/73 - 75 10531F 445 TAGCAGGCTAGCAGAAATGG /
CTGTGACTCCAGCTGTTT
10975R
75 - 79 10937F 447 CAAATCCTGGAAGACCACAA /
AAACCATGCGGGAATCAG
11383R

Legend:


Exons:
exons amplified. Length: size amplified fragment in base pairs. Forward / reverse primer: forward and reverse primer for amplification (Hamed et al. 2006). NOTE - the original publication contained several errors, corrected above (highlighted in red). I gratefully acknowledge Jungae Lee (Seoul National University Hospital, Seoul, Korea) for pointing out these errors.


Other primers

Target F-primer Location R-primer Location Length Reference
Dp427l           Nishio
Dp427c AAACAGCTGGCATGGAGATGAAAGA Dp427c exon 1 GCAGTGCCTTGTTGACATTGTTCAG exon 4 231 Holder
Dp427m TTGGTGGGAAGAAGTAGAGGACTG Dp427m exon 1 GCAGTGCCTTGTTGACATTGTTCAG exon 4 235 Holder
Dp427p CAGCAAAAAGCTTTCCTATGAAGG Dp427p exon 1 GCAGTGCCTTGTTGACATTGTTCAG exon 4 366, 284 Holder
exon 2A CAAGGTTATGGCCTAGCTGAGAAGAG exon 2A .... .... .... Gualandi 2006
exon 2A .... .... CAGAAGGATGAATAATGTGTCTTC exon 2A .... Gualandi 2006
DpdelC CTCAGCACTCTGGAAGACCT exon 60 tgcttttgctactactcacGTTTC intron 70 1203 Tinsley
Dp140 ACACTAGCAATGGCAAAGCT Dp140 exon 1 CTTGCTCAAGCTTTTCTTTTAGTTGC exon 46 412 Lidov
Dp71 ATGTTCGTGCTGCTGCTTTAGACG Dp71 exon 1   exon 75 1393 Tinsley
Dp40 ATGAGGGAACACCTCAAAGGCCA Dp71 exon 1 tgcttttgctactactcacGTTTC intron 70 1014 Tinsley

Legend:
Target: dystrophin isoform to detect. F-primer: forward primer for amplification. Location location forward primer. R-primer: reverse primer for amplification. Location: location reverse primer. Length: size amplified fragment in basepairs. Reference: publications containing details regarding the primers.



| Top of page | LMDp home page |
| DMD-diagnosis: DNA-analysisprotein analysiscell / tissue analysis |
| Remarks / information | Copyright, liability |