Leiden Muscular Dystrophy pagesİ

Primers for analysis of Caveolin-3 (CAV3)

(last modified December 17, 2004)


Contents



DNA-primers

Amplified Length Primer Name Reference
forward reverse
exon 1
(-38 - i1)
176 AGCTCGGATCTCCTCCTGTGG ccgaggcaggcctgcagagcc HC3-7F/E1-3 McNally
exon 2
(i1 - 257)
194 gagttgaggcttccccttgcc CGAACAGGAAGCCCCAGAGCA HC3-E2-5/-2 McNally
exon 2
(169 - 441)
273 GTGTGGAAGGTGAGCTACAC CAGCACCACCTTGATGCTGCTGCA CAV17/CMB Minetti
exon 2
(208 - 441)
234 TACTGGTGCTACCGTCTGTTG CAGCACCACCTTGATGCTGCTGCA CAV8/CMB Minetti
exon 2
(216 - 482)
267 CTACCGTCTGTTGTCCACGCT tgccaccgctgttgccccacc HC3-1/-3UTR McNally
exon 2
(538 - 1330)
793 tggcgagctctttctctttag ATTTCCATAGTGAGTCCACACACG CAV10/7 Minetti

Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and added primer tails in italics. Amplified: region amplified. Numbering of exons is according to McNally, see Reference sequence. Length: length of PCR-product in basepairs. Primer /forward: sequence of forward primer / reverse: sequence of reverse primer. lower case lettering indicatis intronic location, bold/italic indicates location in alternatively spliced "intron 2" (see above). Name: name of the primers. Reference: publication describing the primer(s).


RNA-primers

Amplified Length Primer Name Reference
forward reverse
-38 - 192 230 AGCTCGGATCTCCTCCTGTGG GGTGGTGTAGCTCACCTTCCA HC3-7F/8R McNally
4 - 441 438 ATGGCAGAAGAGCACACAGATCTC CAGCACCACCTTGATGCTGCTGCA   Minetti
.. - 399     GAAGAGTGGGTTGCAGAAG   Minetti
78 - 277 200 CCGAGACCCCAAGAACATTAAC CGAACAGGAAGCCCCAGAGCA HC3-3/2 McNally
216 - 482 267 CTACCGTCTGTTGTCCACGCT tgccaccgctgttgccccacc HC3-1/3UTR McNally
538 - 1330 793 tggcgagctctttctctttag ATTTCCATAGTGAGTCCACACACG   Minetti

Legend:
Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and added primer tails in italics. Amplified: region amplified. Numbering of exons is according to McNally, see Reference sequence. Length: length of PCR-product in basepairs. Primer /forward: sequence of forward primer / reverse: sequence of reverse primer. lower case lettering indicatis intronic location, bold/italic indicates location in alternatively spliced "intron 2" (see above).   Name: name of the primers. Reference: publication describing the primer(s).




| Top of page | LMDp homepage | Muscular dystrophies |
| Remarks / information | Copyrightİ, liability |