Leiden Muscular Dystrophy pages

Primers for CAPN3 analysis

(last modified December 29, 2005)



DNA-primers

Amplified Length Reference forward primer reverse primer Name
  185 Richard ATaAGATGACTGCCTGCCAACGTACAAC ttcctgtgagtgaggtctcg 550delA-F
  182 Richard TAGATGACTGCCTGCCAACGTACAC   550delA-R
645-765 121 Richard CTACGAAGCTCTGAAAGGTG GGCTTTCTTCATGATCTTGT G222R-F
Richard CTACGAAGCTCTGAAAGGTA G222R-R
i6 - i7 325 Richard ctctggttactgctctacaa agcacgaaaagcaaagataaa IVS6-1G>A-F
Richard ctctggttactgctctacag IVS6-1G>A-R
1447-i11 197 Richard GCCCTGATGCAGAAGAACC ccaggagctctgtgggtca R489W-F
Richard GCCCTGATGCAGAAGAACT R489W-R
Richard GCCCTGATGCAGAAGAACCG ccaggagctctgtgggtca R489Q-F
Richard GCCCTGATGCAGAAGAACCA R489Q-F
1697-i13 114 Richard AGGGGGAATTCATCCTCCG ttcaacctctggGagtgggcc R572W-F
Richard AGGGGGAATTCATCCTCTG R572W-R
Richard AGGGGGAATTCATCCTCCG ttcaacctctggGagtgggcc R572Q-F
Richard AGGGGGAATTCATCCTCCA R572Q-R
    Richard AAGAATGGGGTTGATTTGGAG GCATTTCGCATCTCGTAGCT S744G-F
    Richard GCATTTCGCATCTCGTAGCC S744G-R
    Richard AAGAATGGGGTTGATTTGGAGA TGCGTCGTTGACTGCATTTC R748Q-F
    Richard TGCGTCGTTGACTGCATTTT R748Q-R
    Richard AAGAATGGGGTTGATTTGGAGA ATGTGTTTGTCTGCGTACC R769Q-F
    Richard ATGTGTTTGTCTGCGTACT R769Q-R
    Richard CACCAGAGCAAACCGTCCAC CAGGGCTTGTTTTGCCTTTG 1872C>T-F
    Richard CAGGGCTTGTTTTGCCTTTA 1872C>T-R
    Richard CAAGGACCTGAAGACACACG ACCCTGTATGTTGCCTTGG 2069delCA-F
    Richard CACAAGGACCTGAAGACACG 2069delCA-R
    Richard CATCTGCTGCTTCGTTAG GGAGATTATCAGGTGAGATGCC 2362change-F
    Richard TGCTGCTTCGTTTCATCT 2362change-R

Legend:
....


DHPLC

Exon Length
(in bp)
Forward primer Reverse primer DHLPC
(in oC)
Prom296ttcagtacctcccgttcaccgatgcttgagccaggaaaac58.5
1A210CTTTCCTTGAAGGTAGCTGTATCGGCTGATGATGGCTGAATAGATGC64.5
1B279GAGGCTGGGGGTGGAAACCCAAGTGgaggtgctgagtgagaggac59
2239actccgtctcaaaaaaatacctattgtccctttacctcctgg58.5
3185ctcacgatctgtgccctgtgtccgctggccctcttaactacactctc61.4
4227ggacacatttcctaacagtaatttgagtctagccccacctcacattctaaag61.7
5262gtgaccccaaattggtcttcatggtaaaaggcttcctgacacttg60.7
6220ccctgtgttgttccctacattctggagggatggtcagttctgata59.5
7169aatgggttctctggttactgccttcatgaggttaacccaggag63
8239acagaagattccctttccagagaatcttcaatactctcatggctcagt63.5
9159cctgcttccttaattcctccattttctcttccccacccttacccttct60.3
10252cctcctcacctgctcccatatttttcggcttagaccctcc64
11242gtgaatgcgtgcttcctttctgaaagtatgtttcctgggctggag62.7
1293attcacatctgaagcatcttccttgtagtgctgcacacaactgctg56.3
13337tgtggcaggacaggaTgttc*ttcaacctctggagtgggcc63
14191gggttctctagaggctggttctgacttttcgcacagaagatctaaac62
1594tcacttattctgcatttactgtttccagtacacacacttcatgctctctacc52.4
16205cagactgtaatcctcccttccttcctgtgtagcgtgctggccaccccac62.1
17146acctctgacccctgtgaaccgcgtcctgggcttggaggtac60
18154tcctgaaccatgaccctcctctctgctttgagacaacgggactc60
19159tcctcactcttctccatcccaccctgtatgttgccttgg62.5
20134gtgtgctgtgtagccctgacctccttgactcccacgcttcattttct60.3
21170gaatggggttgatttggagattcagcacatccctgccaccccttc61.4
22179ctccacgtccacctctaacatggagagggcagcccccctctccca61.4
23137tctggcctgtgcattctttcacccctccaccttgagttttaatg58.5
24131gggtcactcttttctgatctacaAGGGTGAAACTGAAATCCTGAG60

Legend:
Primers for DHPLC analysis of the CAPN3 gene (modified from Richard et al., as published by Piluso et al. [2005]). PCR at 60oC. Exon: exon amplified. Length (in bp): length of amplified fragment in base pairs. Forward primer: sequence of forward PCR-primer. Reverse primer: sequence of reverse PCR-primer. DHLPC (in oC): DHLPC melting temperature.
*primer published is gtggcaggacaggaCgttc; present in only 1/3 GenBank sequences (potential polymorphism). 


DHPLC

ExonLength
(in bp)
Forward / reverse primerT anneal
(in oC)
DHPLC
(in oC)
1780ctaccatgcagtctctcttg /
AGGTGCTGAGTGAGAGGA
5556.0 and 61.0
2301agccaagattgcaccagt /
TTACTGGAAGCAAGCACAGA
6057
3366GGGTTGACACCTCTGTAAGG /
GAAGTTTCCTCCAGCTTCTG
6061.2
4279GAAGGACACATTTCCTAACA /
CTTCCTGTGAGTGAGGTCT
5259.4
5379GAACATCACAGCATCCAAGA /
CAGTTCCTGCTTCCTCAAAC
5858.8
6390CCTTTGTCTGTCCCATCTCT /
TATTTCAACCCAGACCCTTG
6060.6
7290cacactttcagggagcaga /
CCCAACAGCTAAGTCCTGA
6056.0 and 60.2
8275acaccctcgcgtaagagat /
ATGGCTCAGTTCCCAACAC
6061
9335TGCTATTGGGTTTCACACTG /
CAAGGGCTGGAATCTGATAA
6058
10402AAAGGAAAGACAGGCTCCTC /
GGACGTCTGGAACAGAGAGA
6061
11289CTCTGTCTCATCCCCTTC /
CCTCTCTGGGAAAGTATGTT
5560.8
12353ATACCCAGTGACCCACAGAG /
CCCTCTCCTATCACAGTCCT
6062
13451TATTTAAGCCTTGGGAGTCG /
GGAGGAGACGTGTCTAGCTG
6057.0 and 62.0
14317GGGTTCTCTAGAGGCTGGTT /
GCCAAAGTAGGATTTGCAGT
6060
15287CTTTTTGGCTCCATGTGATT /
AGCAGAAGCTCAGGAAGGA
6058
16397GCTTGTCAGTGGCAGAGATA /
TTCAAACCTCCAGATGTTCA
6061
17314CTCACCAGGTCTGCATTT /
AGTCCAAAGTGACCTCTACC
5561.2
18+19318taatagcaccgacagggatt /
TCAGGGTCTCCTTAAGTTTCC
5856.0 and 60.0
20+21586aatctctgactggtggtgga /
ATGTTAGAGGTGGACGTGGA
6061
22368GGGAGGGGACTAGGCTACTA /
GATGGAGCAGACTGGAGATT
6060
23293ATTCTCTGCCTGCACATCTT /
CACCACTGTGTGGAAATGAG
6059.4
24697CTCTTGCCCCGTAAGATTC /
ATTGGAAGCCATTCAGTCAT
6062

Legend:
Primers for DHPLC analysis of the CAPN3 gene (Hermanova et al. [2006]). Exon: exon amplified. Length (in bp): length of amplified fragment in base pairs. Forward / reverse primer: sequence of forward / reverse PCR-primer. T anneal (in oC): annealing temperature PCR. DHLPC (in oC): DHLPC melting temperature.


RNA-primers


Richard & Beckman

Set Amplified Length Nucleotides Forward primer /
Reverse primer
Name
A 1-4 696 -189_-170
507_526
CAGCTCGGTTTTTAAGATGG /
CGTCCACCCACTCTCCATAG
A1a/A1m
1-3 552 -64_-43
488_468
CTTTCCTTGAAGGTAGCTGTAT /
AAGATCCCTGCGTAGTTTTCG
A2a/A2m
B 1-10 1006 274_293 /
1279_1260
AAGTTCCCCATCCAGTTCGT /
GAAGCTTGTCAGACTGCAGA
B1a/B1m
2-10 914 341_360 / 
1254_1235
ATGGAGCCAACAGAACTGAC /
GGCCGTGAGGTTGCAGATCT
B2a/B2m
C 7-16 906 998_1017 /
1903_1884
GTCACGCCTACTCTGTCACG /
GCTTTTGCTTATCAGGGCTT
C1a/C1m
8-16 759 1085_1104 /
1843_1824
AGGTGGAGTGGAACGGTTCT /
GCTCCTTGTTGCTGTTTGCT
C2a/C2m
D 14-24 869 1751_1770 /
2619_2600
TTGAAAATACCATCTCCGTG /
GGGGTAAAATGGAGGAGGAA
D1a/D1m
16-24 721 1802_1821 /
2522_2503
CCATCATCTTCGTTTCGGAC /
GGGTGAAACTGAAATCCTGA
D2a/D2m

Legend:
Primers for nested RT-PCR. Nucleotides: nucletoide numbering according to the CAPN3 coding DNA Reference Sequence. Reference: primers according to Richard I & Beckmann J (2001) Molecular diagnosis of calpainopathies. Muscular Dystrophy; Methods and Protocols (Ed. Bushby KMD & Naderson LVB) Humana Press, pp 273-287.


 Chrobakova 

RT-PCR
set
LocationLength
(in bp)
Forward / reverse primer
A-256 - 340 CCAAGTCAACATTGCTTCAG
    CAATGATAAATCGGGGATTC
B222 - 826 TTATGTGGACCCTGAGTTCC
    TTCCATAGGTCATGTTCGTG
C643 - 1243 TCCTACGAAGCTCTGAAAGG
    TGCAGATCTCCAACTTTGTG
D991 - 1588 GTCAGAGGTCACGCCTACTC
    AGGCGTTGTACAGGAAGAAG
E1402 - 2001 GACGATGACCCTGATGACTC
    CTCCATGTCATCTCCTGCTA
F1937 - 2536 AGGAAAGTGAGGAACAGCAA
    GCTTTGGAAATAGAGGGTGA

Legend:
RT-PCR set: RT-PCR sets described by Chrobakova et al. (2004). Location: position of primer sequences in relation to the CAPN3 coding DNA Reference Sequence (NOTE: location has not been verified yet). Length (in bp): length of amplified segment in base pairs. Forward / reverse primer: sequence of forward and reverse primer. 



Top of page | LMDp homepage |
| CAPN3 homepage | CAPN3 sequence varaints |
| Remarks / information | Copyright, liability |