PTT for Emery-Dreifuss Muscular Dystrophy

(last modified September 24, 2004)


Contents



Introduction


The Protein Truncation Test for point mutation detection in the EMD-gene (Emery-Dreifuss Muscular Dystrophy) has been published as;

EMD entry in OMIM  /  EMD entry LocusLink


PTT protocol


RNA isolation

RNA was purified from peripheral blood lymphocytes or from cultured Epstein-Barr virus transformed lymphoblastoid cell lines following standard procedures{ref}.


Reverse transcription and PCR

One g total RNA was reverse transcribed in a 60 l reaction, with 400 U Superscript II RT in 5*First Strand Buffer (Gibco BRL), using 1 g random hexamer primers (Promega), 0.01M DTT, 1 mM dNTP's and 40 U RNasin at 42C for 1 h. 5 l of the cDNA reaction was used for a first round PCR amplification. PCR conditions: 0.5 M of each dNTP's, 15 pmol of each primer (Em2F-T7 and Em2R), 0.75mM MgCl2, 10*buffer 3 (Expand long template kit, Boehringer Mannheim), 0.75 l enzyme mix (Expand long template kit) in 25 l final volume. PCR was for 2 min. at 94C, followed by 35 cycles of 30 sec. at 94C, 30 sec. at 64C, 1 min. at 72C and a final elongation of 7 min. at 72C. 0.1 l of this PCR reaction was used in a second round PCR amplification. PCR conditions: 0.2 M of each dNTP's, 3.5 pmol of each primer (Em1F-T7 and Em1R-M13), 2 mM MgCl2, 10*buffer (Perkin Elmer), 2 U Taq polymerase (Perkin Elmer) in 50 l final volume. PCR was for 2 min. at 94 C, followed by 28 cycles of 30 sec. at 94C, 30 sec. at 64C, 1 min. at 72C and a final elongation of 7 min. at 72 C.


Table of primer sequences

Name Location Sequence
Em2F-T7 2 - 22 T7-GGCCGGTTTTGGTAGGCCCGG
Em1F 39 - 57 T7-CGCCTGAGCCCGCACCCGC
Em1R-M13 875 - 895 M13-CCCACTGCTAAGGCAGTCAGC
Em2R 959 - 979 GGGGAGCAAGCACTACTCTGG

Legend:
Name: laboratory primer name. Location: Location of primer on the emerin cDNA-sequence (accession nr M...., GenBank). Sequence: primer sequence, T7- = ..., M13- = ....


In vitro transcription translation (non radioactive)

General protocol from Leiden including SDS-PAGE analysis of translation products, electro blotting, detection of proteins, interpretation, protein marker, estimation of the part of the PTT fragment to be sequenced and troubleshooting.



| Top of page | EMD mutation database | EMD entry LocusLink |
| PTT home page | LMDp homepage |
| Remarks / information | Copyright, liability |