Leiden Muscular Dystrophy pages

Lamin A/C (LMNA) primers for mutation screening

(last modified February 11, 2005)


Contents



DNA

SSCA

Amplified Length Forward primer /
reverse primer
Name Reference
exon 1 574 CCCAGATCCCGAGGTCCGAC /
cctctccactccccgcca
1F/1R Bonne et al., 1999
349 CCCAGATCCCGAGGTCCGAC /
AGCCCTGCGTTCTCCGTTTC
1aF/1aR Bonne et al., 2000
268 ACATCGACCGTGTGCGCTC /
cctctccactccccgcca
1bF/1bR Bonne et al., 2000
exon 2 242 gactccttctcttaaatctactctcc /
tgtgttaggtggggccatgc
2F/2R Bonne et al., 2000
exon 3 232 ttcttgtgttctgtgacccctt /
ac ccaagtctgtcatcaccca
3F/3R Bonne et al., 2000
exon 4 273 bg t ccctgggtcttggcctcc /
cggcagtgagggaaccaat c ga
4F/4R Bonne et al., 2000
exon 5 231 cctccacccctcccagtcac /
tgcatccggcccagactcta
5F/5R Bonne et al., 2000
exon 6 300 caaaccctcccacccccc /
dccagt t gccgg (g) ccagag
6F/6R Bonne et al., 2000
exon 7 292 ccccacttggtctccctctcc /
ccctgatgcagctgtatcccc
7F/7R Bonne et al., 1999
exon 8 229 ccaagagcctgggtgagcctc /
gacacttaccccagcgctcc
8F/8R Bonne et al., 2000
exon 9 192 ggagcgctggggtaagtgtc /
ctcgtccagcaagcagccag
9F/9R Bonne et al., 1999
exon 10 319 acccttccctggccctgac /
cacctgggttccctgttcaag
10F/10R Bonne et al., 2000
exon 11 359 tggtcagtcccagactcgcc /
cgcctgcaggatttggaga
11F/11R Bonne et al., 2000
exon 12 197 tgagggatgggggagatgct /
gggtgggcatgaggtgagga
12F/12R Bonne et al., 2000

Legend:
Primers for PCR and mutation detection using SSCA (Bonne et al., 2000). a C>A in polymorphism in genomic sequences, b T is C in 2/3 genomic sequences, c C>A in polymorphism in genomic sequences, d T>C polymorphisms in genomic DNA, G not present in 2/3 genomic sequence.


DHPLC

Data copied from the Toniolo-lab (DHPLC analysis LMNA and EMD gene)

Exon

Length
(in bp)

Forward primer /
reverse primer

Name

Hot Start Denat. Anneal. Elong. Fin. ext.

cycles

1a

350

CCCAGATCCCGAGGTCCGAC /
AGCCCTGCGTTCTCCGTTTCC

LA1F/
LMNA1aR2

96°
5 min
96°
1 min
61
45 sec
72°
1 min
72°
7 min 

35

 1b

332

ACCCGCATCACCCGGCTG /
CCTCTCCACTCCCCGCCA

LMNA1bF2/
1bR

96°
5 min
96°
1 min
61
45 sec
72°
1 min
72°
7 min

40

 2

339

ATTGCAGGCATAGCAGCGC /
GAGGGCCTAGGTAGAAGAG

LA2FB/
LA2RF

96°
5 min
96°
1 min
57
30 sec
72°
1 min
72°
7 min

40

 3

232

TTCTTGTGT TCTGTGACCCCTT /
CCCAAG TCTGTCATCACCCA

LMNA3F2/
3R2

96°
5 min
96°
1 min
61
1 min
72°
1 min
72°
7 min

40

 4

341

GTCCCTGGGTCTTGGCCTCC /
GCCACCATCTGCCTGATCC

LMNA4F/
LA4R

96°
5 min
96°
1 min
62
45 sec
72°
1 min
72°
7 min

40

 5

231

CCTCCACCCCTCCCAGTCAC /
TGCATCCGGCCCAGACTCTAG

LMNA5F/
5R

96°
5 min
96°
1 min
61
1 min
72°
1 min
72°
7 min

40

 6

376

CAGCTGTCTCCTACACCGACC /
GGTCTAGTCAAGGCCAGTTGC

LA6F/
6R

96°
5 min
96°
1 min
61
1 min
72°
1 min
72°
7 min

40

 7

359

GAGGTGCTGGCAGTGTCC TC /
CTTCTGTCTTGCCAC TCT CTC C

LA7F/
7R

96°
5 min
96°
1 min
63
45 sec
72°
1 min
72°
7 min

40

 8

205

ACCCAAGAGCCTGGGTGAGC /
CACCCAAGGTCTCCCCAGAG

LA8F/
8R

96°
5 min
96°
1 min
61
45 sec
72°
1 min
72°
7 min

40

 9

239

TTGGGTGTCGATGGGAGCGC /
GCAGCTGCC TCCGATGTTGG

LA9F/
9R

96°
5 min
96°
1 min
61
1 min
72°
1 min
72°
7 min

40

 10

319

ACCCTTCCCTGGCCCTGAC /
CACCTGGGTTCCCTGTTCAAG

LMNA10F/
10R

96°
5 min
96°
1 min
59
1 min
72°
1 min
72°
7 min

40

 10B

214

GCAAGCTGGTGCGCTCAGTG /
GGCCAGGCCAGCGAGTAAAG

LA10FB/
10RB

96°
5 min
96°
1 min
62
45 sec
72°
1 min
72°
7 min

40

 11

359

GGTCAGTCCCAGACTCGCC /
CGCCTGCAGGATTTGGAAGAC

LMNA11F/
11R

96°
5 min
96°
1 min
59
1 min
72°
1 min
72°
7 min

40

 12

198

GTGAGGGATGGGGGAGATGC /
GGGTGGGCATGAGGTGAGG

LMNA12F/
12R

96°
5 min
96°
1 min
61
45 sec
72°
1 min
72°
7 min

40

DHPLC conditions

Exon

T analysis
(in °C)

Acetonitrile gradient
(%)

1a

 

66

51-56-64

68

49-54-62

1a

 

65

52-57-65

66

51-56-64

2

 

62

51-56-64

64

49-54-62

3

 

61

48-53-61

63

46-51-59

4

 

63

50-55-63

66

45-50-58

5

65

48-53-61

6

65

50-55-63

7

 

64

52-57-65

65

51-56-64

8

 

62

48-53-61

64

45-50-58

9

64

49-54-63

10

65

48-53-61

10b

 

64

46-51-59

66

45-50-58

11

 

65

52-57-65

67

48-53-61

12

 

62

47-52-60

63

46-51-59


DHPLC / SSCA MacLeod et al. (2003)

 Exon Length
(in bp)
Forward primer /
reverse primer
 
1A   CCCAGATCCCGAGGTCCGAC /
R:AGCCCTGCGTTCTCCGTTTCC
 
1B   ACCCGCATCACCCGGCTG /
CCTCTCCACTCCCCGCCA
 
2   GCGGCCCGCCGCCCCCGCCGCTCCTTCTCTTAAATCTACTCTCC /
GCGGCCCGCCGCCCCCGCCGGCTCTGAAATCAGGTGACAG
 
3   TGTTCTGTGACCCCTTTTCC /
CCAGCCCAAGTCTGTCATC
 
4   AGCACTCAGCTCCCAGGTTA /
CCGCCGCCCCCGCCCGGTAAGGGTAGGGCTGCCAAG
 
5   GCGGCCCGCCGCCCCCGCCGTAGCAGTGATGCCCAA /
GCCCGCCGCCCCCGCCCGCATCCGGCCCAGACTCTA
 
6   GTCCCTCCTTCCCCATACTT /
CCAAGTGGGGGTCTAGTCAA
 
7   GAGGTGCTGGCAGTGTCC /
GCGGCCCGCCGCCCCCGCCGCTTGCCACTCTCTCCCTGAT
 
8 / 9   GCGGCCCGCCGCCCCCGCCGTGGGCCTTTG /
TCTAGAAAGGGGCCCTGAAT
 
10   CTACCCGGAGAGCTTGACAG /
TTCCCACTCCCTTCCTTACC
 
11   GCCCCCGCCGCCTGAGCCTTGTCTCCCTTC /
GCGGCCCGCCGCCCCCGCCGTGCAGGATTTGGAAGACAAA
 
12   CCCCTGTTGTTCACACCTCT /
GGGTTATTTTTCTTTGGCTTCA
 

NOTE: primer sequences were not verified.


DHPLC  Taylor et al. (2004)

 Exon Length
(in bp)
Forward primer /
reverse primer
Melting 
temp. (oC)
Name
1 530 CCGAGCAGTCTCTGTCCTTC /
CCCTCTCACTCCCTTCCTG
67 1F/1R
2 312 GCGGCCCGCCGCCCCCGCCG-CTCCTTCTCTTAAATCTACTCTCC /
GCGGCCCGCCGCCCCCGCCG-GCTCTGAAATCAGGTGACAG
62 2F/2R
3 230 TGTTCTGTGACCCCTTTTCC / CCAGCCCAAGTCTGTCATC 63 3F/3R
4 367 AGCACTCAGCTCCCAGGTTA / CCGCCGCCCCCGCCCG-GTAAGGGTAGGGCTGCCAAG 64 4F/4R
5 348 GCGGCCCGCCGCCCCCGCCG-TAGCAGTGATGCCCAACTCA /
GCCCGCCGCCCCCGCCCG-CATCCGGCCCAGACTCTA
66.5 5F/5R
6 361 GTCCCTCCTTCCCCATACTT / CCAAGTGGGGGTCTAGTCAA 67 6F/6R
7 352 GAGGTGCTGGCAGTGTCC /
GCGGCCCGCCGCCCCCGCCG-CTTGCCACTCTCTCCCTGAT
66 7F/7R
8 / 9 496 GCGGCCCGCCGCCCCCGCCG-TGGGCCTTTGAGCAAGATAC /
TCTAGAAAGGGGCCCTGAAT
64.5 /
65
8-9F/8-9R
10 503 CTACCCGGAGAGCTTGACAG / TTCCCACTCCCTTCCTTACC 60 /
66.5
10F/10R
11 330 GCCCCCGCCG-CCTGAGCCTTGTCTCCCTTC /
1GCGGCCCGCCGCCCCCGCCG-TGCAGGATTTGG AGACAAA
66.5 11F/11R
12 184 2gCCCTGcTGcTCACACCTCT / GGGTTATTTTTCTTTGGCTTCA 63 / 64 12F/12R

NOTE: some primer sequences do not match the genomic sequence; 1reported as TGCAGGATTTGGAAGACAAA, 2reported as CCCCTGTTGTTCACACCTCT. Italics - length not verified.


Direct sequencing

I      From De Sandre-Giovannoli et al. (2002)

Exon Froward primer /
reverse primer
1 M13F-ccgagcagtctctgtccttc /
M13R-ccctctcactcccttcctg
2 M13F-gcactgtctaggcacacagact /
M13R-gggagggcctaggtagaaga
3 M13F-tgtgaccccttttcctcatc /
M13R-cactagggcaagggactcag
4 + 5 M13F-ggcctcccaggaactaattc /
M13-Rgtggggacacttttcatccc
6 + 7 M13F-cttccccatacttagggccc /
M13R-aaggatgttcctctctccac
8 + 9 M13F-gcaagatacacccaagagcc /
M13R-gctccgatgttggccatcag
10 M13F-gtagacatgctgtacaaccc /
M13R-ggccagcgagtaaagttcca
11 M13F-ttgggcctgagtggtcagtc /
M13R-gacccgcctgcaggatttgg
12 M13F-atcgaggggtaggacgaggt /
M13R-taaggcagatgtggagtttcc

M13F = tail sequence GGTGTAAAACGACGGCCAGT (M13 universal) added to 5' end forward primer, M13R = tail sequence GGCAGGAAACAGCTATGACC (M13 reverse) added to 5' end reverse primer.

II    Data copied from the Seidman laboratory

ExonFroward primer /
reverse primer
Name
1CCCAGATCCCGAGGTCCGAC /
CCTCTCCACTCCCCGCCA
1f/r
2CAGACTCCTTCTCTTAAATCTAC /
CCTAGGTAGAAGAGTGAGTGTAC
2f/r
3CCTTCAAGTTCTTGTGTTCTGTGAC /
CCTAGCCCAGCCCAAGTCTGTC
3f/r
4GGCCTCCCAGGAACTAATTCTG /
CTCCCTGCCACCATCTGC
4f/r
5GCTGTAGCAGTGATGCCCAAC /
CCAAAGCCCTGAGAAGTGAAG
5f/r
6GCCAGGACTATGTTTAGAGCTTG /
GGTCTAGTCAAGGCCAGTTG
6f/r
7CCCCACTTGGTCTCCCTCTCC /
CCCTGATGCAGCTGTATCCCC
7f/r
8GAGGCCTCAATTGCAGGCAGGC /
GAAAAGGACACTTACCCCAGC
8f/r
9GGAGCGCTGGGGTAAGTGTC /
CTCGTCCAGCAAGCAGCCAG
9f/r
10GTAAGCAGCAGGCCGGACAAAG /
CACAGGAATATTCCATGGCATC
10f/r
11GGAGCCTGCAGGAGCCTGGAGC /
GCTGCGGAAGAGAAGGCAGGCTC
10f/r
12CTTGTCTGAGCCCCAGACTGGAG /
12f
GGGGTGGCAGCTTCGGGGACAATC /
AGGGAAAAGGAAGGGAGGAGAAAT
12F04/R04

PCR conditions

Primers1st 
denature
DenatureAnnealingExtentionFinal
ext.
Cycles
1f & 1r94C, 4 min94C, 30 sec67C, 30 sec72C, 30 sec72C, 4 min35
2f & 2r94C, 4 min94C, 30 sec58C, 30 sec72C, 45 sec72C, 4 min35
3f & 4r94C, 4 min94C, 30 sec60C, 30 sec72C, 45 sec72C, 4 min30
4f & 5r94C, 4 min94C, 30 sec59C, 30 sec72C, 45 sec72C, 4 min35
6f &7r94C, 4 min94C, 30 sec58C, 30 sec72C, 45 sec72C, 4 min35
7f & 8r94C, 4 min94C, 30 sec64C, 30 sec72C, 45 sec72C, 4 min30
9f & 11r94C, 4 min94C, 30 sec67C, 30 sec72C, 45 sec72C, 4 min30
12F04 & 12R0494C, 4 min94C, 30 sec58C, 30 sec72C, 45 sec72C, 4 min35


| Top of page | LMDp homepage |
| LMNA homepage | NMD mutation detection | Muscular dystrophies |
| Remarks / information | Copyright, liability |