Leiden Muscular Dystrophy pages

LAMA2 primers for mutation screening

(last modified November 29, 2005)


Contents



DNA

SSCA

Amplified Length (in bp) Forward primer /
reverse primer
PCR Reference
exon 1 244 cctcttccccagcagctg / ccaagcccatgcctcgac 53oC
exon 2 225 caccttcatttgtccatc / gccacacacctacacact 55-50oC
exon 3 214 catatgatgctgctaact / ccacaaaccactaactaa 45-40oC
exon 4 306 tgttgttgttatacttccct / tatcaaatgtgcttaaatgg 55-50oC
exon 5a 240 tgggagaatgggaagtta / GCAAACATCATCAAGTCAG  55-50oC Guicheney 1998
exon 5b 163 GCTCGCTATATTCGCCTGAG /
gtgggatatcatttgtaggctct
Di Blasi 2005
exon 6 151 

ctctggattgctttttgcag /
cagggcttcattttgcctaa

Di Blasi 2005
exon 7 211 gcttcctttatggttcta / atgacgatattttgttgg 45-40oC
exon 8 340 taaatgtatctgaaatcaaatt / gttcaactgtttacagaagc 55-50oC
exon 9 205 gtttctattcacttcgtt / aatcatatttggctttta 44-39oC
exon 10 222 ttgttttagaaatgttga / ttactggaataaacaatg 44-39oC
exon 11 229 cgcagctcataatgttga / gcagcaaacagaaccaaa 50-45oC
exon 12 271 aaaagctgctgatagata / tcagttaaagcagaatag 45-40oC
exon 13 195 tgatttaatagcccatct / acatcaggaagtaacacg 45-40oC
exon 14 303 ctcttttcagttttactc / caaagtaaatgtgtgaac 44-39oC
exon 15 177 acttattcaccatctctt / aagcactaaggatacatt 50-45oC
exon 16 229 ccaagactgactaaagcc / ccagggtagtagctgaat 50-45oC
exon 17 209 tgatccctgacaccaaaa / gagcttattcatggggta 50-45oC
exon 18 175 ctttgtgtatgtccttct / aatcattttgcaagacag 45-40oC
exon 19 317 aatatctaaacattgccc / acatcaattctgtcaggg 45-40oC
exon 20 159 tgatcacaggtctctctt / ttatgggtcagcctctac 50-45oC
exon 21 262 acttcgagttaactgatt / atgtaggacttaagtcat 44-39oC
exon 22 212 tttctatttttccccttctttg / tatcaatgagcaaaaaagtggt 55-50oC
exon 23 325 aaagttgttaatggttgc / gaaacagaattgagggag 44-39oC
exon 24 245 ctcccgttatgcattctc / ggctcagcagttccctac 50-45oC
exon 25 332 catgcagttcgtaactta / gataaatctccaaatggt 45-40oC
exon 26 263 accactttggagactttatc / caccaaacaatgactaactt 55-50oC
exon 27 210 cattcagttttgtcatag / aaaataagagcttgaata 44-39oC
exon 28 168 atctaagtacattctcgc / caggttagtaggaggtag 50-45oC
exon 29 244 tgtctttgcagccactga / ttcaaggaaggctcagag 50-45oC
exon 30 194 acaaacttcttctccctt / gtttctgattgggaaata 50-45oC
exon 31 173 caatccttttctttctga / tgtgaccctttaccatat 45-40oC
exon 32 269 tgtggagacatgacttgc / cagcaaagcagtatacgt 55-50oC
exon 33 226 tctgcctgggatgtttag / ctgccctgcttgtgactg 50-45oC
exon 34 223 atgtttatgggatggaat / taggaagaaggtgatttg 55-50oC
exon 35 167 gtgtttcccgaatttggt / atgatgattaaatgtgat 55-50oC
exon 36 259 tggcatgtttgtttacta / ctggaaatctcagtttgt 50-45oC
exon 37 312 accctaaggcagtgacat / cccaaccttctgagatta 44-39oC
exon 38 169 tgtcttgttcataatggt / tctcttttgagttttacc 44-39oC
exon 39 207 aaatgccctcttctctac / ccaaaacaaatgacatac 55-50oC
exon 40 208 ccctgcatactgtttttgaat / gacttccattcccagcacat 55-50oC
exon 41 201 catttgtttttctgtccac / tccaatagtgtgatagaa 55-50oC
exon 42 192 gctgagggatgataaaac / gttggtagtgcctgaatg 55-50oC
exon 43 262 gccactaactccacaccc / acacaatgaaaaaggaga 55-50oC
exon 44 197 tttgttttgcttccatgtga / ttccttttacgcatctacc 55-50oC
exon 45 218 atatacatgcacactaat / cagttctgatatgacgat 45-40oC
exon 46 229 caaactttctgagagatt / agcagcctaatgaaaagt 50-45oC
exon 47 189 tgatatctcttgtttttg / aatctttattaagttggt 44-39oC
exon 48 214 tccccttcacttcaacac / acaggaggaggatgaaca 50-45oC
exon 49 175 taacggtatttctttctg / accctgggagagttctca 50-45oC
exon 50 247 tgacagaccgaatagata / cacggaaactctgctatg 44-39oC
exon 51 207 ccactggggtatgtttac / ggcctatattgcattatt 44-39oC
exon 52 228 atgtggttgatattgctc / aacttaatccttagcttt 44-39oC
exon 53 129 ttcctctttcccgttatct / tggtgttgctctgcttctg 55-50oC
exon 54 221 attgcttttgcttttcat / agcagccacactaagtaa 50-45oC
exon 55 234 tgtctactcttccttttcct / tgcattatcagctaggtgtg 55-50oC
exon 56 256 ctaaagctaagccataaa / ggaagttcacctgagtta 45-40oC
exon 57 255 tgtattgaatcagatgtg / gtagtagtaatgaggaga 45-40oC
exon 58 264 aaaatcttatttattaca / tcccttctgaaatgactc 44-39oC
exon 59 229 ttagacagcatcattacc / tcttcatttatcggttct 53-48oC
exon 60 298 gataccgctctattttag / gtaatcccttagggtact 45-40oC
exon 61 268 tctgcatatgtgaaattt / tcaataaatgaatcagcc 45-40oC
exon 62 309 tacacacatagagcaccc / tggatctagcaagaagtt 44-39oC
exon 63 229 atcctctaatccaaaata / atctacacatcaacaata 44-39oC
exon 64 319 tgtgtgaaccatcatgat / gaaattgttgctggggta 50-45oC
exon 65 334 gccctcttgcattgcctt / 
TCTGGAGT*CTG*AATTAGCA
55-50oC

Legend:
Primer sequences for SSCA taken from Guicheney et al. [1998] - sequences were not checked. Exon: exon number according to these pages. Length: length of PCR fragment in bp. Forward primer /
reverse primer:
sequence of forward and reverse primer. UPPERCASE = sequence in exon, * = sequence differs from that published (but agrees with cDNA Reference Sequence). PCR: touchdown-PCR with initial and final annealing temperature given. PCR was for 2 cycles at each temperature, going down in 1oC steps and for 30 cycles at the final annealing temperature. Each cycle: 40 sec at 94oC denaturation, 1 min extension at 72oC, Final extension 2.5 min 72oC.  NOTE: exon numbering in Guicheney et al. [1998] skipped exon 6.


RNA

PTT

Amplified Length Forward primer /
reverse primer
Name
    [T7]-TCCTCTGGCTCCCGAGAAGTG /
GTGTCAAGGATGAGAAACATGCTCG
8F / 1350R
    [T7]-TGTGATCAGTGCTGTCCAGGAT /
ACTTGGACTCACCTCAGCAGATC
1001F / 1750R
    [T7]-GCCTGTAACTGCAGTGGGTTAGG /
AATACAGGCCAATGCAACTGTC
1451F / 3293R
    [T7]-GACTGTGAAGAGAGTGGACAATG /
GCAGAAGGACTTGACGACTACCG
2981F / 4527R
    [T7]-CAAAGCAGGATTTCTGAAATCTC /
CAGGTCCTCGGGGTTTATTAAAGG
4101F / 5942R
    [T7]-GGCAATGACATACTCGATGAAGC /
TTCCGTTGTCAGCAATCAAAACCAT
5552F / 7300R
    [T7]-TTCCGAGAAAAAGAAGGTGACTGC /
CATGGCTGGGATCAATCATGCTG
7001F / 8537R
    [T7]-TTGGGAAGTGGAGGGACACCAG /
TGACACAAATGACCCTGTGTTTG
7741F / 9245R

Legend:
Eight overlapping  primers covering most (~97%) of the LAMA2c DNA coding sequence (Pegoraro et al. [1998]). After RT-PCR, these primers are used in a nested PCR reaction. Subsequently, PCR products are transcribed and translated and synthesized protein products are analysed on PAA-gel. Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and added primer tails in italics. Amplified: region amplified. Numbering of exons is according to the cDNA Reference Sequence. Length: length of PCR-product in basepairs. Forward primer / reverse primer: sequence of forward and reverse primer. Name: name of the primers. [T7] = ggatcc-TAATACGACTCACTATAGGG-agaccaccatg (BamHI cloning site, T7 promoter sequence and translation initiation sequence resp.).


RT-PCR + SSCA

PCR Amplified Length Forward primer /
reverse primer
Name
1 exon 1 - 6 880 CTCCTCCTTCTGCTGCTC /
GCTGGATCAAGTGGACAA
1F / 1R
2 exon 1 - 4 415 GCAGTCACAGGCACAT /
CTGCCAGGGCTTGTATTC
2F / 2R
1  exon 5 - 13 1093 TGCTCACAAAGACCCAAG /
GCTGGAGAACACGTTCTG
3F / 3R
2 exon 5 - 13 1002 ACCCCATTGTCACCAGAA /
TGTCCTCCTACTGCTGGG
4F / 4R
1  exon 12 - 18 813 GGACGACTTGGACTCACC /
TCCAAGACTCCGGTCTAA
5F / 5R
2  exon 12 - 18 662 TGCCGCACAGCTACTACT /
CTTTAGTAGGCTCGCCAT
6F / 6R
1  exon 18 - 23  831 ACACAGGTGGCCCATATT /
AGTGGTAATGCTGTGGCC
7F / 7R
2   exon 18 - 23 677 TTTAGACCGGAGTCTTGG /
CAGGTATTGGGTGCACAT
8F / 8R
1  exon 22 - 28  993 TGTGCACCCAATACCTGG /
CAGCTGGAGGAGTCATTG
9F / 9R
2 exon 22 - 28 905 GGGCCACAGCATTACCAC /
TGTCGCATGAAATTTCCA
10F / 10R
1 exon 27 - 33 836 GGATGATCCTCGAGTCCA /
ATGACCATCTGCTCCAGG
11F / 11R
2 exon 30 - 33 203 AGGGATTGCCAAATGACT /
ACCGAGAAGAAGGCCAGT
12F / 12R
1 exon 33 - 38 809 ACTGGCCTTCTTCTCGGT /
TTCATCTGCAAGACGGTT
13F / 13R
2 exon 33 - 38 767 CCTGGAGCAGATGGTCAT /
CGGTTGGCTTCATCGAGT
14F / 14R
1 exon 37 - 43 832 GCTAATCGCCTATTTGCA /
GCGACGCTGTCTGCTAGT
15F / 15R
2 exon 37 - 43 761 GGAGAAAAAGAAGGAGGC /
TTCTTCTTCAGGCCATCG
16F / 16R
1 exon 43 - 50 886 TCCACCAGAACCTCGATG /
ACGGCTGACCAATGCATA
17F / 17R
2 exon 43 - 50 798 CGATGGCCTGAAGAAGAA /
GCATCCTTTGCAGTCACC
18F / 18R
1 exon 50 - 56 829 GGTGACTGCAAAGGATGC /
AGATGCACTTCCAGACGG
19F / 19R
2 exon 50 - 56 737 TATGCATTGGTCAGCCGT /
GCCCCTGTTGAGGAGTAT
20F / 20R
1 exon 56 - 61 915 GCAGACTGGACAGGCCTA /
CATTCCCACGACATCCAG
21F / 21R
2 exon 56 - 61 866 ATACTCCTCAACAGGGGC /
GGCTTTTTTGGGACTGAT
22F / 22R
1 exon 61 - 65 767 ATGTAGATGGGGCTTCCA /
GATACAGGTTGAACGCCC
23F / 23R
2 exon 61 - 65 723 ATCAGTCCCAAAAAAGCC /
CTCAGTTCCAGGGCCTTG
24F / 24R

Legend:
All primer sequences from Helbling-Leclerc et al. (1995); after RT-PCR products were analysed using SSCA (3 electrophoresis conditions). Exonic sequences are in upper case, intronic and gene flanking sequences in lower case and added primer tails in italics. Amplified: region amplified. Numbering of exons is according to the cDNA Reference Sequence. Length: length of PCR-product in basepairs. Reference: publication describing the primer(s). Forward primer / reverse primer: sequence of forward and reverse primer. Name: name of the primers.



| Top of page | LMDp homepage |
| LAMA2 homepage | NMD mutation detection | Muscular dystrophies |
| Remarks / information | Disclaimer |